ID: 1184091653

View in Genome Browser
Species Human (GRCh38)
Location 22:42296078-42296100
Sequence CACAAAACTCAGATGGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184091653_1184091660 26 Left 1184091653 22:42296078-42296100 CCTTAGCCCATCTGAGTTTTGTG 0: 1
1: 0
2: 2
3: 6
4: 126
Right 1184091660 22:42296127-42296149 GACTTAGACCCCTGCCTGGCAGG 0: 1
1: 0
2: 1
3: 8
4: 178
1184091653_1184091657 4 Left 1184091653 22:42296078-42296100 CCTTAGCCCATCTGAGTTTTGTG 0: 1
1: 0
2: 2
3: 6
4: 126
Right 1184091657 22:42296105-42296127 CTACCGAGTGAAGATGTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 64
1184091653_1184091659 22 Left 1184091653 22:42296078-42296100 CCTTAGCCCATCTGAGTTTTGTG 0: 1
1: 0
2: 2
3: 6
4: 126
Right 1184091659 22:42296123-42296145 TCAGGACTTAGACCCCTGCCTGG 0: 1
1: 0
2: 2
3: 123
4: 5177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184091653 Original CRISPR CACAAAACTCAGATGGGCTA AGG (reversed) Intronic
904452504 1:30623247-30623269 CACAACACTAAGATGGGAGAGGG - Intergenic
905895987 1:41546050-41546072 CACTAAACTCAGAGGGGCCATGG - Intronic
906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG + Intronic
907154088 1:52316327-52316349 CACAAAAATTAGCTGGGCTTTGG + Intronic
909657988 1:78052016-78052038 CAAAATACTATGATGGGCTACGG + Intronic
910361251 1:86415373-86415395 CTCACAACTCAGTTGGGGTATGG + Intergenic
911772253 1:101760770-101760792 CACAAAAATCATATGTACTATGG - Intergenic
912312177 1:108633852-108633874 ATCAAAGCTCAGAGGGGCTAGGG - Intronic
915419567 1:155769066-155769088 CACAAAACTCACTTGAACTAGGG - Intronic
918095337 1:181329698-181329720 AACATAAATTAGATGGGCTAGGG - Intergenic
1067942986 10:50671540-50671562 CACACAACTGAGATAGGATAGGG + Intergenic
1070864228 10:79696501-79696523 CACACAACTGAGATAGGATAGGG + Intergenic
1071631127 10:87218727-87218749 CACACAACTGAGATAGGATAGGG + Intergenic
1077775646 11:5268751-5268773 CAAAAAATTCAGATGAGCTTAGG + Intronic
1081348392 11:42018364-42018386 CACAAACCTCAGATAGGAGAAGG - Intergenic
1082829880 11:57608488-57608510 AACAAAACTCATATTGGCTTGGG - Intronic
1084848014 11:71916083-71916105 CACAGAGCTCAGAAGGGCTGAGG + Exonic
1086890623 11:92254083-92254105 CACCACACTCTGATGGGCTCTGG + Intergenic
1087658212 11:100952887-100952909 CACAAAAATCAGCTGGGCACTGG - Intronic
1092760026 12:11801725-11801747 AATCAAACTCAGATAGGCTAAGG + Intronic
1094461790 12:30704230-30704252 CACAAAACCCAGAAGCCCTAAGG - Intergenic
1096618379 12:52847447-52847469 CACAATTCACAGATGGGCTGTGG - Intronic
1098043918 12:66380394-66380416 CAGAGAACTCAGAAGGGCAACGG + Intronic
1100740870 12:97590929-97590951 CATATATGTCAGATGGGCTAAGG + Intergenic
1101362540 12:104041594-104041616 AACAAAGCTAAGATGGGATAAGG + Intronic
1101855815 12:108441909-108441931 TACAAAACGCACATGTGCTAGGG - Intergenic
1114733015 14:25014338-25014360 TACAAAAATCAGCTGGGCTCAGG + Intronic
1115999374 14:39226610-39226632 TAAAGAACTCAGATGGGCTGGGG - Intergenic
1119753916 14:77100394-77100416 CACAAAAATTAGCTGGGCTTGGG - Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1126248126 15:46535000-46535022 CACAAAACTAATGTGAGCTATGG - Intergenic
1127250437 15:57230828-57230850 CACAAACCTCACATAGGCTCAGG - Intronic
1130687769 15:86053982-86054004 CACAAAAATCAGATGGGCAAAGG - Intergenic
1131588712 15:93724478-93724500 TTCAAAACTCAGATGGTCTGAGG - Intergenic
1137740749 16:50770603-50770625 CACAAAAATTAGCTGGGCTCGGG - Intronic
1138601324 16:58056361-58056383 TACAAAAATCAGCTGGGCTTGGG + Intergenic
1140462848 16:75154951-75154973 TACAAAAATTAGCTGGGCTATGG - Intronic
1144140308 17:12341442-12341464 CTCAAGGCTCAGATGGGCTCTGG + Intergenic
1147854556 17:43469228-43469250 CACCGAACTTAGATGGGGTATGG - Intergenic
1150269926 17:63857288-63857310 AAGAAAACTCAGGTGGGCAAAGG + Intergenic
1150328440 17:64275267-64275289 CACAAATCTCAAATGGGCACTGG + Intergenic
1150536657 17:66049593-66049615 TACAAAAATCAGCTGGGCCATGG + Intronic
1152287141 17:79419514-79419536 CACAAAATTCAGAGGCGCTCAGG + Intronic
1156053901 18:32974441-32974463 TATAAAACTCTGATGGGATATGG + Intronic
1157010374 18:43641129-43641151 GAGAAAAATCAGATGGGCTGTGG + Intergenic
1157556945 18:48619084-48619106 CACAAACCTCTGAGGGGCTCAGG - Intronic
1162399170 19:10434358-10434380 CAAAAAAATTAGCTGGGCTATGG - Intronic
1165076654 19:33283211-33283233 CAGAGACCTCAGAGGGGCTAGGG + Intergenic
1166052813 19:40270511-40270533 CAGACAGCACAGATGGGCTAGGG + Intronic
926862680 2:17325578-17325600 CACAGAACACTGAGGGGCTATGG + Intergenic
927086508 2:19678145-19678167 CACAAACCTCACTTGGGCCAAGG - Intergenic
927290056 2:21396343-21396365 CCCAAAGCTCAGATGGTTTATGG - Intergenic
931146101 2:59520598-59520620 CACACAACCCAGATGGGCAAGGG + Intergenic
931460587 2:62447171-62447193 CAGAGAACTCAGATGGGGAAGGG + Intergenic
931575709 2:63716367-63716389 CGCAAAACTTAGCTGGGGTAGGG - Intronic
931790054 2:65656992-65657014 TACAAAACTTAGCTGGGCTGTGG + Intergenic
936011678 2:108929134-108929156 CAGAAAACCCCGAGGGGCTACGG - Intronic
936034353 2:109098873-109098895 CTCAAATCTCAGATGGGTTCAGG + Intergenic
938750566 2:134325182-134325204 TACAAAAATCAGAAGGGCAAAGG + Intronic
939674582 2:145056168-145056190 CACAAAAATTAGCTGGGCTTGGG + Intergenic
941031572 2:160517476-160517498 CACAAATCACTGAGGGGCTAAGG + Intergenic
944150962 2:196558238-196558260 TTTCAAACTCAGATGGGCTATGG + Intronic
1171244940 20:23603400-23603422 CAGGAAACTCAGATTGGCCAGGG + Exonic
1172945581 20:38685764-38685786 CCCAAAGCTCAGATAGGATATGG - Intergenic
1178673365 21:34611929-34611951 CCCAAAAACCAGGTGGGCTAAGG - Intronic
1183268167 22:36843728-36843750 CATAAAATTCAGATGGGGGATGG - Intergenic
1183305162 22:37079101-37079123 CAGAAAACTCAGATGGGCCAAGG - Intronic
1184091653 22:42296078-42296100 CACAAAACTCAGATGGGCTAAGG - Intronic
1184424518 22:44401626-44401648 TACAATAATCAGATGGGCTGAGG - Intergenic
1184482161 22:44754051-44754073 CACAAGAATCAGCTGGGCTCAGG - Intronic
951168784 3:19513440-19513462 CACAAAACTCAGAAAAGCTGAGG - Intronic
951295481 3:20928343-20928365 CACAACACTGAGATGTGCAAAGG - Intergenic
954638215 3:52083105-52083127 CACATACCTCAGAGGAGCTAAGG - Intronic
954888481 3:53900070-53900092 CACATCACTCAGATGGTCAAAGG - Intergenic
955235199 3:57132937-57132959 CACAAAACTGAGTTGGGTTTGGG + Intronic
956367589 3:68521733-68521755 CACAGAACTCATAAGGGATAGGG + Intronic
957252338 3:77789278-77789300 CTTATAACTGAGATGGGCTAGGG + Intergenic
963061351 3:141229709-141229731 CACAGATCTCAGATAGGTTAAGG + Intronic
964139849 3:153385317-153385339 AACAGAACACAGATGGGCTTGGG - Intergenic
965730670 3:171768781-171768803 CACACATCTCAGATGGTTTATGG - Intronic
967883884 3:194320357-194320379 TACAGATCTCAGATGGGCCATGG - Intergenic
967993426 3:195148955-195148977 CATAAAACAAAGATTGGCTAAGG + Intronic
969372888 4:6745421-6745443 CACAAAAATTAGCTGGGCCATGG + Intergenic
972691032 4:41398394-41398416 CACAAAACTCAGTTGGATGACGG - Intronic
978374699 4:108062448-108062470 CATAGGACTCAGAAGGGCTAGGG + Intronic
980682771 4:136186276-136186298 CTCAAAACTAAGATGGGGCAGGG + Intergenic
980905872 4:138948195-138948217 TACAAAAATTAGCTGGGCTATGG + Intergenic
983002021 4:162426904-162426926 CACAAAGATAGGATGGGCTAGGG - Intergenic
983116197 4:163819381-163819403 CACAGAATTCAGATGTGCAATGG - Intronic
987714249 5:21546306-21546328 TACAAAAGTCAGATGGGTTCTGG - Intergenic
988906503 5:35796210-35796232 CAGCAAGCTCTGATGGGCTATGG - Intronic
994277499 5:97855939-97855961 CACAAAACACAGAAGCCCTATGG + Intergenic
994590176 5:101761781-101761803 CCCACAACTCAGTTGGGATATGG + Intergenic
996308692 5:122078533-122078555 CAAAAAACTCAGACAGGCGAAGG + Intergenic
996893966 5:128456991-128457013 CAAAAAACTATGATGAGCTAAGG + Intronic
998177273 5:139909611-139909633 CACTAAAATGAGAAGGGCTAAGG - Intronic
999940478 5:156537234-156537256 CACAAAACACAGATGTGCCAAGG - Intronic
1000005733 5:157182808-157182830 CACAAATAGCAGTTGGGCTAAGG - Intronic
1000204496 5:159045938-159045960 AACAAAGCTCAGATAGGCTATGG - Intronic
1000763732 5:165258607-165258629 CACAAAACTCAGCAGGGATTTGG + Intergenic
1001360560 5:171081108-171081130 CTTTAAACTCAGATGGACTAGGG - Intronic
1001406883 5:171482766-171482788 CACAGATGTCAGATGTGCTATGG - Intergenic
1002653069 5:180718075-180718097 CACAAAACAGAGATGGGGCAGGG + Intergenic
1004189954 6:13455243-13455265 CACAAAACTCAGTTCGGGTTGGG - Intronic
1009002477 6:57735773-57735795 TACAAAAGTCAGATGGGTTCTGG + Intergenic
1010916993 6:81632349-81632371 CACAAAACTCACATGCTTTAAGG + Intronic
1011575177 6:88789698-88789720 CACCAAACACAGTTGGGCCAAGG + Intronic
1016086971 6:139926367-139926389 CACAAAACGCAGATGGAAGAGGG - Intergenic
1016502448 6:144736868-144736890 CAGAAAACTGGGATGGGCAATGG - Intronic
1020147010 7:5652384-5652406 AACAGAATTCAGAGGGGCTATGG - Intronic
1025144625 7:56493065-56493087 TACAAAGGTCAGATGGGCTTGGG - Intergenic
1026531446 7:71201523-71201545 CACAAAATTTAGATTGGATACGG + Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1029563618 7:101320593-101320615 AATAAAGCTCAGATGGACTAAGG - Intronic
1029700130 7:102241147-102241169 TATAGAACTCAGAGGGGCTAAGG + Intronic
1031949348 7:127875992-127876014 CACAAAATTCTGATGAGATAGGG - Intronic
1032904403 7:136347778-136347800 CACCAAGCTCAGAGGGGCTGTGG + Intergenic
1033001986 7:137515668-137515690 CAGAAAACTCAGACAGTCTAAGG - Intronic
1033501227 7:141951813-141951835 CACTAAACTCAACTGGGCCAGGG - Intronic
1038522977 8:28249107-28249129 AACAAAACATGGATGGGCTATGG + Intergenic
1048229139 8:132620128-132620150 CACAGATCTCAGATGGACTCTGG - Intronic
1051785919 9:20743542-20743564 CATAAAATTCAGAGGGGCTAAGG - Intronic
1052280500 9:26727624-26727646 CACAAAAGTTTGATGAGCTAAGG + Intergenic
1058022293 9:100102251-100102273 CACAAAAATTAGCTGGGCTGTGG - Intronic
1060902466 9:127272239-127272261 CACAAAACTGAGTTGTGTTAGGG - Intronic
1061444975 9:130632488-130632510 CACAAACCTCAGGCGGGCTGGGG + Intronic
1185726074 X:2422955-2422977 CACAAAAATTAGCTGGGCTTGGG - Intronic
1185866054 X:3624971-3624993 CACTCAACTCAGATGGGATTTGG + Intronic
1187505636 X:19876056-19876078 TTCAAAACCCAGATGGGTTAAGG + Intronic
1190301708 X:49060839-49060861 CACAATACACAGATGGGGAAGGG + Intronic
1192606839 X:72527363-72527385 CACTAAACTCAACTGGGCTGTGG - Intronic
1193582270 X:83280829-83280851 CTCAAAACTCAGATTGACTGGGG - Intergenic
1196685262 X:118505177-118505199 CACAAAACTTAGCCGGGCAATGG - Intronic
1199133065 X:144217370-144217392 CACAAAACACAGATAAGCAATGG + Intergenic
1200797770 Y:7357356-7357378 CACTCAACTCAGATGGGATTTGG - Intergenic