ID: 1184094958

View in Genome Browser
Species Human (GRCh38)
Location 22:42311458-42311480
Sequence CACCTTTCCTAAAGGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184094956_1184094958 -9 Left 1184094956 22:42311444-42311466 CCTCTAGAAGTGATCACCTTTCC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1184094958 22:42311458-42311480 CACCTTTCCTAAAGGACAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 228
1184094955_1184094958 19 Left 1184094955 22:42311416-42311438 CCTCAGGGTGGTGTGGGGATCAA 0: 1
1: 1
2: 1
3: 19
4: 221
Right 1184094958 22:42311458-42311480 CACCTTTCCTAAAGGACAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184094958 Original CRISPR CACCTTTCCTAAAGGACAAA AGG Intronic
902127122 1:14224212-14224234 CAGATTTCATAAAGGCCAAAGGG + Intergenic
903562369 1:24237415-24237437 CACCTTTCCTACAGGGGAAGGGG - Intergenic
905256738 1:36689543-36689565 CCTCTTTCCCAAAAGACAAAGGG + Intergenic
906409471 1:45567273-45567295 CACCTTTTCTAAATGAATAAAGG - Intronic
906420293 1:45660382-45660404 CACGTTTCCAAAAGGGGAAAGGG + Exonic
910502236 1:87905928-87905950 CCCTTTTCCTTAAGGGCAAATGG + Intergenic
911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG + Intronic
912195915 1:107396720-107396742 AAGCTTTCCTAAAGTAAAAATGG + Intronic
912442180 1:109707649-109707671 CATTTGTCTTAAAGGACAAAGGG - Intronic
913416635 1:118616280-118616302 CACCTTTACTAAAAGAAAAATGG - Intergenic
914434904 1:147651230-147651252 AACATTTCTTCAAGGACAAATGG - Intronic
915632011 1:157159919-157159941 CACCTTTCTTACAGGGCCAACGG + Intergenic
916419899 1:164627199-164627221 CATTTTTCCTTAAGGAAAAAAGG - Intronic
917675613 1:177316372-177316394 CTGCTTTCCCAAAGGATAAAAGG + Intergenic
918125346 1:181578914-181578936 CTCCTTTCCTAAAGGAAATTAGG - Intronic
920851526 1:209631361-209631383 AACCATTGCTAAAGGCCAAAAGG - Intronic
922375502 1:224960201-224960223 CAGCTTCCCTTAAGGAGAAAGGG + Exonic
923943580 1:238857026-238857048 CACCTTTGCTACAGGGCAGATGG + Intergenic
1063318478 10:5030678-5030700 CACCCTCCTTAAAGAACAAAAGG - Intronic
1065241524 10:23709587-23709609 CTTCTTTCCTAATGGAAAAATGG + Intronic
1066308098 10:34166851-34166873 CACCTTTCCTTAAGGAGAAATGG - Intronic
1070618963 10:77991986-77992008 GACCATTTCTAGAGGACAAAAGG + Intronic
1073501355 10:103940742-103940764 CATCCTGCCTACAGGACAAAAGG + Intergenic
1074693093 10:116024902-116024924 CACTTTTCATCAAGGACACAGGG - Intergenic
1075261035 10:120963962-120963984 CACCTGTCCAAGAAGACAAAGGG + Intergenic
1075728356 10:124622192-124622214 CAGCAGTCCTCAAGGACAAACGG + Exonic
1076046179 10:127295828-127295850 CACCTTCTCTTAAGAACAAAAGG - Intronic
1076356983 10:129860398-129860420 CATCTTCCCCAAAGGACAAAAGG - Intronic
1076601401 10:131659066-131659088 CACCTTACATAAAGCAAAAATGG - Intergenic
1078034883 11:7793546-7793568 CACCTTTCCTTAGGGTCAATTGG - Intergenic
1079530560 11:21447321-21447343 CACCTTTTCTCAAGCAGAAAGGG + Intronic
1079627487 11:22633804-22633826 CACCATTCCTACAGAAGAAAAGG - Intronic
1080237824 11:30092533-30092555 CAGATTTGCTAAAGGTCAAATGG - Intergenic
1080957818 11:37121242-37121264 CTCATTTTCTTAAGGACAAAGGG - Intergenic
1082126160 11:48433518-48433540 CCCATTTCCTAAAGAATAAATGG - Intergenic
1082559751 11:54604369-54604391 CCCATTTCCTAAAGAATAAATGG - Intergenic
1082643616 11:55694147-55694169 CATCTTTACTCAAGGAAAAAAGG - Intergenic
1083179702 11:60977275-60977297 CTCCTGTCCTAAAGGACAGTTGG - Intronic
1086975009 11:93121267-93121289 CAGGTTTCCCAAAGGAGAAATGG + Intergenic
1086996695 11:93365987-93366009 CAACTTGCCTAAAGGTCACAGGG - Intronic
1087258783 11:95986855-95986877 CACCTATTCTAAAGATCAAAAGG - Intronic
1087417019 11:97870301-97870323 CACTTTTACTAAAGGACAATAGG - Intergenic
1087634788 11:100689902-100689924 CATCCTTCCTAAGGGACAAAAGG - Intronic
1090627431 11:128619022-128619044 CACCTTTCCTAAGGCACAGTGGG - Intergenic
1092876358 12:12851535-12851557 CACATTTCCTGCAGCACAAAGGG + Intergenic
1094194819 12:27737409-27737431 CAGTTTTCCTAAAGCAGAAAAGG + Intronic
1095652065 12:44623414-44623436 CATCTTTTCTAAAATACAAAAGG + Intronic
1096971865 12:55673026-55673048 CCCATTTCCTATAGGACAAGAGG + Intergenic
1100503651 12:95198339-95198361 TATCTATCTTAAAGGACAAAAGG + Intronic
1101277127 12:103215098-103215120 AATCTTTCCCAAAAGACAAAGGG + Intergenic
1101409310 12:104456300-104456322 CACCATTCCTCAAGGCAAAAGGG - Intronic
1101601855 12:106216502-106216524 CAGCTTTCCTCAAGTACAACTGG + Intergenic
1102144989 12:110648338-110648360 AACATTTCCAAAAGGAAAAAAGG - Intronic
1102732730 12:115127231-115127253 TACCTTTCCCATAAGACAAATGG + Intergenic
1104109350 12:125690333-125690355 CACATTTCCTAAAGAATGAATGG + Intergenic
1104833612 12:131772293-131772315 CACCTTTCCTAACGATCAACGGG - Intronic
1104963182 12:132497804-132497826 CACCCTTCTTTAGGGACAAATGG - Intronic
1106153397 13:27128518-27128540 CACCTTACCTAAGGCAAAAAGGG + Intronic
1107036129 13:35904632-35904654 CTTCTTTCCTAAAGGCAAAAGGG - Intronic
1107869023 13:44730002-44730024 CACCTCTGCCAAAGGACAATTGG - Intergenic
1109749353 13:66669703-66669725 CACCTATACTAAAGGAACAAAGG + Intronic
1111111942 13:83722818-83722840 AAACTTTCCAAAAGGAAAAATGG + Intergenic
1115381325 14:32743457-32743479 CACCTTTACTAAAGGAAGACAGG - Intronic
1115531544 14:34332721-34332743 GACCTTTTCTGAACGACAAATGG + Intronic
1115715005 14:36093926-36093948 TTCCTTTCCTAAAGGACATGTGG + Intergenic
1116821036 14:49628148-49628170 AACCTTTCCTAAAATAAAAAGGG + Exonic
1116930463 14:50685663-50685685 CCCCTTTAATAAAGGAAAAAAGG - Intergenic
1117255001 14:53968597-53968619 CACTTTTCTTAAATGATAAAAGG - Intergenic
1118055040 14:62070804-62070826 CACCTTCCCAAAAGGAAAGAAGG - Intronic
1119376038 14:74194112-74194134 CACCTTTCCCCAATGACATATGG - Intronic
1121290460 14:92770421-92770443 CTCCTTCCCTAAAGGATATAAGG + Intergenic
1121745239 14:96284103-96284125 CAAGTTTCCTTAAGGGCAAATGG + Exonic
1125013617 15:34908088-34908110 CACCTTTTCAAAGGGACAAAAGG + Intronic
1125169416 15:36749400-36749422 CCAGTTCCCTAAAGGACAAAAGG - Intronic
1126501007 15:49344960-49344982 CACTTTTTCTAAAGTATAAATGG + Intronic
1126744996 15:51817446-51817468 TACCTTGCCTCAAGGACAGAGGG + Intergenic
1129974917 15:79814019-79814041 CACCTTTCCTCAAGGTCATGTGG + Intergenic
1132062864 15:98707104-98707126 CACCCTGCCTGAAGGACACAGGG - Intronic
1133715315 16:8441611-8441633 CAACTTTCTGAAAGGACAGAGGG - Intergenic
1134166784 16:11936633-11936655 CAACTTACCCAAAGGAAAAAAGG + Intronic
1134348003 16:13409365-13409387 CACCTTTCTGCAAGGACAGAGGG - Intergenic
1134493922 16:14717079-14717101 CAACTTACCCAAAGGATAAAAGG - Intronic
1134499302 16:14756203-14756225 CAACTTACCCAAAGGATAAAAGG - Intronic
1134525851 16:14942823-14942845 CAACTTACCCAAAGGAAAAAAGG - Intronic
1134546555 16:15113538-15113560 CAACTTACCCAAAGGAAAAAAGG + Intronic
1134547040 16:15118021-15118043 CAACTTACCCAAAGGAAAAAAGG + Intronic
1134581267 16:15372810-15372832 CAACTTACCCAAAGGAAAAAAGG + Intronic
1134621777 16:15694798-15694820 CAAATTTCCTAGAGGAAAAACGG - Intronic
1134684164 16:16147095-16147117 CACCTTTTCTTAAGGACACAGGG - Intergenic
1135312175 16:21414050-21414072 CAACTTACCCAAAGGAAAAAAGG + Intronic
1135365123 16:21846506-21846528 CAACTTACCCAAAGGAAAAAAGG + Intronic
1135446716 16:22524833-22524855 CAACTTACCCAAAGGAAAAAAGG - Intronic
1136098748 16:27977857-27977879 CACCGTTCAGAAAAGACAAATGG + Intronic
1136147370 16:28323207-28323229 CACCTCTCCTAAGGGGCAAAGGG - Exonic
1136151346 16:28351970-28351992 CAACTTACCCAAAGGAAAAAAGG + Intronic
1136167578 16:28465811-28465833 CAACTTACCCAAAGGAAAAAAGG + Intronic
1136195398 16:28649204-28649226 CAACTTACCCAAAGGAAAAAAGG - Intronic
1136211736 16:28763320-28763342 CAACTTACCCAAAGGAAAAAAGG - Intronic
1136256457 16:29043271-29043293 CAACTTACCCAAAGGAAAAAAGG - Intronic
1136308878 16:29393041-29393063 CAACTTACCCAAAGGAAAAAAGG + Intronic
1136322295 16:29494572-29494594 CAACTTACCCAAAGGAAAAAAGG + Intronic
1136436974 16:30234544-30234566 CAACTTACCCAAAGGAAAAAAGG + Intronic
1138336690 16:56258966-56258988 CACTTTCCATAAAGAACAAAGGG - Intronic
1140366148 16:74382585-74382607 CAACTTACCCAAAGGAAAAAAGG - Intronic
1141050342 16:80755938-80755960 CATGTTTCCTAAATGACTAAGGG - Intronic
1144465841 17:15496491-15496513 TACCTTTCCTGAAGGACACTGGG + Intronic
1146483886 17:33227870-33227892 CACCTTTCCTAGAGCACAACAGG - Intronic
1148533184 17:48415225-48415247 CACATTTCCAAAAAGAAAAATGG + Intronic
1150792150 17:68207512-68207534 CACCTTACTTCAAGGAAAAAAGG - Intergenic
1151881933 17:76901109-76901131 CACCTTTCCTAAGGAAAGAAAGG - Intronic
1152623942 17:81379878-81379900 CACACTTCGAAAAGGACAAATGG + Intergenic
1154118055 18:11628737-11628759 CAACTTACCCAAAGGAAAAAAGG + Intergenic
1155372039 18:25111995-25112017 AAGCTTCCCTAAAGGACAAAGGG + Intronic
1155387659 18:25297697-25297719 CACTTTCCCTAAAGGACCTATGG - Intronic
1155513686 18:26602811-26602833 CAAATATCCTAAAGAACAAAGGG + Intronic
1156037643 18:32783706-32783728 CACTTTTCTTATAGGTCAAATGG + Intergenic
1156201546 18:34838150-34838172 CAGCTTTTCTGAAGGGCAAAGGG + Intronic
1158988624 18:62845727-62845749 CACAATCCCTAAAGGACAAGTGG - Intronic
1159846535 18:73467844-73467866 CAAATTTCTTAAAGGACAATTGG - Intergenic
1160126094 18:76173405-76173427 CACATTTCCAGAATGACAAATGG - Intergenic
1160556037 18:79725894-79725916 CAGCTTACCTACAGGAAAAACGG - Intronic
1161155539 19:2730541-2730563 CACCTGGGATAAAGGACAAATGG + Intronic
1164001373 19:21103227-21103249 TACTTTTTCTAAAGGAAAAATGG - Intronic
1165933172 19:39373327-39373349 GAAGTTTCATAAAGGACAAAAGG - Intronic
1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG + Intronic
1167742293 19:51330985-51331007 CACCTTTCCAAAAGGATCCAGGG + Intergenic
925072321 2:979541-979563 CAGCTTCCCAAAAGGCCAAAAGG - Intronic
927897515 2:26793414-26793436 AACCTTTACTAGAGAACAAAGGG - Intronic
928986763 2:37189765-37189787 CAACTTACCCAAAGGAAAAAGGG - Intronic
929923090 2:46187234-46187256 GGCCTTTCCTACAGGACAACTGG + Exonic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932055836 2:68442976-68442998 AAACATTCCTAAAAGACAAATGG + Intergenic
932120845 2:69098547-69098569 CACATTTCCAAAAAGAAAAAAGG + Intronic
933022688 2:77214636-77214658 AACCTTTCCTTAAGTACAATAGG + Intronic
937029406 2:118725510-118725532 CATCTTTCCAAGATGACAAATGG + Intergenic
937081283 2:119141809-119141831 CACGTTTCCTACAGGGCAAGTGG - Intergenic
939818900 2:146931111-146931133 CACCTTATCAAAAGGACAGAGGG - Intergenic
940682520 2:156804421-156804443 CACCTTTTCTCAAGGACCTATGG - Intergenic
942298536 2:174540046-174540068 CACCTTTTCAAAAGGAACAAAGG + Intergenic
943014039 2:182489726-182489748 CAGTTTTCCAGAAGGACAAAAGG + Intronic
943118687 2:183707603-183707625 CACCTTTACTAAAGGAAGACAGG - Intergenic
948872368 2:240809445-240809467 CACCTTTCCCAGATGTCAAAAGG - Intronic
1170832798 20:19857929-19857951 CACATTTTCAAAAGAACAAAAGG - Intergenic
1172178754 20:32987889-32987911 CACATTTCCTAGAGGAGAACAGG - Intronic
1176277164 20:64278987-64279009 CACCTTTCCTAGAGATTAAAGGG + Intronic
1178595631 21:33950162-33950184 CAGCTTTCCTTAAGGAGGAATGG - Intergenic
1181506291 22:23360465-23360487 CAACTTTCCCCAAGCACAAATGG + Intergenic
1182321672 22:29481781-29481803 CAGCTTCCCTAAAGGAGAAAGGG - Intronic
1183027597 22:35077376-35077398 CAACTTTCCTACAGGAAAAGAGG - Intronic
1183116391 22:35695581-35695603 CATTTTTCCTAAAGGGCAGAGGG - Intergenic
1183706428 22:39477420-39477442 CACCTTTGTTAAGGTACAAAAGG - Intronic
1184094958 22:42311458-42311480 CACCTTTCCTAAAGGACAAAAGG + Intronic
1184792120 22:46706642-46706664 CGCCTTCCCTAAAAGCCAAAGGG + Intronic
949734151 3:7151684-7151706 CTTTTTTCCTAAAGGGCAAAGGG - Intronic
950188671 3:10961158-10961180 CACCTTGCATCAAGGACAAGGGG - Intergenic
955251594 3:57288402-57288424 CACCTTTTATGAAAGACAAATGG + Intronic
955903957 3:63787577-63787599 AACCTTCCCTAAAGGACAGTGGG - Intergenic
956037330 3:65108538-65108560 GACATTTCCTAAAAGACAAGTGG + Intergenic
957353911 3:79058049-79058071 CATTTTTCTTAAAGGAGAAAGGG - Intronic
957853909 3:85848297-85848319 CCCCAATCTTAAAGGACAAAAGG + Intronic
958727998 3:97929638-97929660 CACCTCTCATAAACAACAAAAGG - Intronic
960982566 3:123244342-123244364 CACCTTTGCTGAAGGACAGCTGG - Intronic
962453829 3:135547049-135547071 CATCTTTCCTAAATCACACAAGG - Intergenic
962693105 3:137920830-137920852 CAGCTTTCTTAAAGTAAAAAGGG - Intergenic
964627809 3:158776255-158776277 CACCTTTTCTACAGGGCAGATGG - Intronic
965340617 3:167486433-167486455 CACCTTACTTAAAAGACATAAGG + Intronic
965823644 3:172709552-172709574 GACCTTTCCTAAGAGACAAAAGG + Intronic
966455330 3:180108589-180108611 CACTTAAGCTAAAGGACAAATGG - Intergenic
966624418 3:182000906-182000928 CAGTTTTCTTAAAGAACAAAGGG + Intergenic
966666592 3:182478479-182478501 CACCTTTTCAAAGGGTCAAAGGG + Intergenic
972112835 4:35586942-35586964 CACATTACATAAAGGACATAAGG - Intergenic
975232033 4:71946765-71946787 CACCTGTCATAAAGAATAAATGG - Intergenic
976604362 4:86968878-86968900 CATCTTTCATAAGGGAAAAAAGG + Intronic
977056311 4:92197013-92197035 CACCTTACATAAAGCACTAAGGG - Intergenic
977440454 4:97059749-97059771 AACTTTTCTTAAAGGATAAAAGG + Intergenic
981282442 4:142973956-142973978 CACCATTCCAAAAGTCCAAAAGG - Intergenic
982750491 4:159155399-159155421 CACCTTTGTTTAAGGCCAAAGGG - Intronic
983430862 4:167648970-167648992 CACTTTTCACAAAGAACAAATGG + Intergenic
983770337 4:171541233-171541255 CCCCTGTTTTAAAGGACAAAAGG + Intergenic
986906402 5:12499029-12499051 CACCTAACATAAAGGATAAAAGG + Intergenic
987848458 5:23318388-23318410 TACCATTACTAAAGGAGAAAAGG - Intergenic
989236205 5:39151226-39151248 CATATTTCCTAAAGGGAAAACGG - Intronic
989814298 5:45717850-45717872 CTCCTTTCCTGAAGTAGAAAGGG - Intergenic
994710450 5:103258931-103258953 CACCTTTTCTGCAGCACAAAAGG - Intronic
995660553 5:114478071-114478093 CACCTGACCTAAAGGAAAACTGG + Intronic
998290266 5:140908051-140908073 CACTTTTCATGAAGGAGAAATGG - Intronic
999255629 5:150208687-150208709 CTCCTTTCTTTAAGGACACAGGG + Intronic
999798448 5:155009843-155009865 CACATTTCTTAAAGGGGAAAAGG - Intergenic
1001121074 5:168980330-168980352 CACCATTCCAAAATGACCAAGGG + Intronic
1001624882 5:173123457-173123479 AACCTTTCATGGAGGACAAAAGG + Intronic
1001942136 5:175748217-175748239 CACCTTCCCTACAGGAGACAGGG - Intergenic
1005421478 6:25655784-25655806 CACTGTTCCTAGAGGAAAAAAGG - Intronic
1005776375 6:29135911-29135933 GGCCTTTCCTAAATAACAAATGG - Intergenic
1006224422 6:32524612-32524634 CATCATTTCTAAAGGGCAAACGG - Intronic
1006591752 6:35163150-35163172 CACCTTTCCTCCAGGAGACATGG + Intergenic
1007523655 6:42472044-42472066 CACCTTTTGTAAACTACAAAAGG - Intergenic
1008118423 6:47581064-47581086 CATTTTTCTTAAAGTACAAATGG + Intronic
1009269233 6:61597696-61597718 AAGCTTTCCAAAAGGACTAATGG + Intergenic
1013078279 6:106790167-106790189 CACCCTTCCTAAAGCAAAAGGGG - Intergenic
1013718556 6:112993980-112994002 CACCTTTTCTATCAGACAAAGGG + Intergenic
1016630668 6:146226468-146226490 CATCTTTCCTGAAGAACAAAGGG - Intronic
1019193259 6:170266625-170266647 CACCTTCCCTCACTGACAAACGG - Intergenic
1019367238 7:640441-640463 CACATTTCCTGAATGACTAATGG - Intronic
1019888685 7:3927451-3927473 CCCCTTTACTACAGGAGAAAAGG - Intronic
1021530506 7:21639389-21639411 CAGCTTTCCTAGGGGAGAAAGGG + Intronic
1022127564 7:27372953-27372975 CATCTTTCCTCATGAACAAAGGG - Intergenic
1023272525 7:38480162-38480184 CACATTTCCTAAAAGTAAAATGG - Intronic
1024565982 7:50681345-50681367 CAGCTTGCCTAAAGTCCAAAAGG - Intronic
1024661021 7:51495058-51495080 CACCTTTGCTAAAGGAAGACAGG - Intergenic
1026381191 7:69800960-69800982 CACCTTTCCTAAACTAGAATAGG + Intronic
1027418611 7:77998280-77998302 CAACTTCCCTAGAGGAAAAAAGG + Intergenic
1028702423 7:93795527-93795549 GACCTTTCACAAAGGAGAAAAGG - Intronic
1028804901 7:95013930-95013952 CAGATTTCCTAAATGAAAAATGG + Intronic
1029498713 7:100914094-100914116 CACCTCTCCTAAGACACAAATGG + Intergenic
1031249016 7:119356149-119356171 AAAAGTTCCTAAAGGACAAATGG + Intergenic
1031452204 7:121935915-121935937 CACATTTCATAAAAGAAAAAGGG + Intronic
1032986321 7:137341816-137341838 CAAGTTTCTTAAAGCACAAAAGG + Intronic
1033448837 7:141444952-141444974 CTCCTTTCACAAAGCACAAAGGG + Intronic
1035611707 8:970435-970457 CACCAGTGCTTAAGGACAAATGG + Intergenic
1035944666 8:3948647-3948669 CAACTTTCCTAAAGAAATAATGG + Intronic
1037352388 8:17975183-17975205 GACCATTCCTATAGCACAAAAGG - Intronic
1037513917 8:19610817-19610839 CACCTTGTCTCAAGGACAGAGGG - Intronic
1038814637 8:30888790-30888812 CACCTTTCATAAAGAACAGGAGG - Intronic
1040858991 8:51979444-51979466 CCCCTGTCCTAAAGGAAATAAGG + Intergenic
1042437268 8:68781847-68781869 CAAATTGCCTAAAGTACAAATGG - Intronic
1043277440 8:78417298-78417320 CACCTTTATTAAAGGAAAACTGG - Intergenic
1051506383 9:17831734-17831756 CTCCTTTCTTATAGGAGAAAGGG - Intergenic
1052063544 9:23989413-23989435 CACCTTTACTAAAGGAAAACAGG + Intergenic
1054778547 9:69144934-69144956 CACCTTTACCCATGGACAAAGGG + Intronic
1057116569 9:92528520-92528542 GAACTAACCTAAAGGACAAAGGG + Intronic
1061696784 9:132381878-132381900 AATCTTTCCTAATGGACCAATGG + Intronic
1187028925 X:15465768-15465790 CACCTTTCCTAAACTTCACATGG - Intronic
1187154179 X:16708665-16708687 CACCTTTCCTGCAGGATTAAGGG + Intronic
1188632471 X:32382526-32382548 CACCTCTCCTAAAGAAAATAAGG - Intronic
1189258585 X:39660106-39660128 CAGATATCATAAAGGACAAAGGG - Intergenic
1192102694 X:68281286-68281308 GATCTTTGATAAAGGACAAAAGG + Intronic
1196573492 X:117290547-117290569 CACCTTTGCTAAAGGAAGACAGG + Intergenic
1198305654 X:135380156-135380178 CAGGTTTCCCAAAGGACAAGAGG - Intergenic
1199016626 X:142823855-142823877 AACCTTTACTCAAGAACAAAAGG + Intergenic
1202173952 Y:22080349-22080371 AACCTTTTCTAAATGACAACTGG - Intronic
1202217408 Y:22506033-22506055 AACCTTTTCTAAATGACAACTGG + Intronic
1202325778 Y:23690026-23690048 AACCTTTTCTAAATGACAACTGG - Intergenic
1202544993 Y:25980028-25980050 AACCTTTTCTAAATGACAACTGG + Intergenic