ID: 1184096221

View in Genome Browser
Species Human (GRCh38)
Location 22:42317894-42317916
Sequence TGCACGGCAGGCAGCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184096221_1184096236 29 Left 1184096221 22:42317894-42317916 CCCTCCTGGCTGCCTGCCGTGCA No data
Right 1184096236 22:42317946-42317968 GCCACACTCCCAGAGCCCTATGG No data
1184096221_1184096238 30 Left 1184096221 22:42317894-42317916 CCCTCCTGGCTGCCTGCCGTGCA No data
Right 1184096238 22:42317947-42317969 CCACACTCCCAGAGCCCTATGGG No data
1184096221_1184096229 7 Left 1184096221 22:42317894-42317916 CCCTCCTGGCTGCCTGCCGTGCA No data
Right 1184096229 22:42317924-42317946 CCATCCCCTGGCAGCCCCATTGG No data
1184096221_1184096226 -5 Left 1184096221 22:42317894-42317916 CCCTCCTGGCTGCCTGCCGTGCA No data
Right 1184096226 22:42317912-42317934 GTGCATGCCTGTCCATCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184096221 Original CRISPR TGCACGGCAGGCAGCCAGGA GGG (reversed) Intronic