ID: 1184096221

View in Genome Browser
Species Human (GRCh38)
Location 22:42317894-42317916
Sequence TGCACGGCAGGCAGCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 419}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184096221_1184096226 -5 Left 1184096221 22:42317894-42317916 CCCTCCTGGCTGCCTGCCGTGCA 0: 1
1: 0
2: 2
3: 44
4: 419
Right 1184096226 22:42317912-42317934 GTGCATGCCTGTCCATCCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 158
1184096221_1184096229 7 Left 1184096221 22:42317894-42317916 CCCTCCTGGCTGCCTGCCGTGCA 0: 1
1: 0
2: 2
3: 44
4: 419
Right 1184096229 22:42317924-42317946 CCATCCCCTGGCAGCCCCATTGG 0: 1
1: 0
2: 0
3: 31
4: 224
1184096221_1184096236 29 Left 1184096221 22:42317894-42317916 CCCTCCTGGCTGCCTGCCGTGCA 0: 1
1: 0
2: 2
3: 44
4: 419
Right 1184096236 22:42317946-42317968 GCCACACTCCCAGAGCCCTATGG 0: 1
1: 0
2: 2
3: 18
4: 202
1184096221_1184096238 30 Left 1184096221 22:42317894-42317916 CCCTCCTGGCTGCCTGCCGTGCA 0: 1
1: 0
2: 2
3: 44
4: 419
Right 1184096238 22:42317947-42317969 CCACACTCCCAGAGCCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184096221 Original CRISPR TGCACGGCAGGCAGCCAGGA GGG (reversed) Intronic
900245518 1:1634391-1634413 TGCGGGGCAGGCAGCCGGGGGGG + Intronic
900583672 1:3422152-3422174 GGCAGGGCAGACAGGCAGGAAGG + Intronic
900800745 1:4735612-4735634 TGTACAGCAGGCAGCCTGGGAGG - Intronic
900860234 1:5223687-5223709 TGCAGGCCAGGCACCCAGCACGG + Intergenic
900961230 1:5922075-5922097 TGAAAGGCAGGGAGGCAGGAGGG + Intronic
900999639 1:6142384-6142406 GGCGGGGCAGGCGGCCAGGAGGG - Intronic
901152888 1:7115805-7115827 TGCAAGGCAGTCAAGCAGGAGGG + Intronic
901858197 1:12057576-12057598 TGCAGGGCAGGCCCACAGGAGGG - Intergenic
901922541 1:12547449-12547471 TGCAGGGCCTGAAGCCAGGATGG + Intergenic
902367913 1:15989488-15989510 TGCAGGGCAGGAAGCCAGCCAGG - Intergenic
903315274 1:22498848-22498870 TGCACAAAAGGCAGGCAGGAAGG + Intronic
903934930 1:26889112-26889134 TGGACGGCAGTCAGCTGGGAGGG + Exonic
904562296 1:31406905-31406927 TGCAGGGCTGGCAGGCAGTAGGG + Intergenic
904624430 1:31794079-31794101 TGCAGGGGTGGCAGCCAGGCTGG - Intronic
905421053 1:37844734-37844756 GGCAGGGCAGGGAGACAGGAGGG - Intronic
905910030 1:41647368-41647390 TGCTAAGCAGGCAGCCAGGAGGG - Intronic
905923487 1:41733999-41734021 TGCACAGCAGCCAGGCAGGAAGG - Intronic
906290664 1:44617530-44617552 TGAACGGCCGTCAGCCCGGAGGG - Intronic
906662252 1:47591050-47591072 TGCACTGCAGGGAACCAGGTGGG + Intergenic
907275760 1:53315830-53315852 TGGAGGGCAGCCAGCCAGGTAGG + Intronic
907437666 1:54459820-54459842 TACAGGGCAAGCAGCCAAGAAGG - Intergenic
907919056 1:58896178-58896200 TGCAACGCATGCAGCCATGAAGG - Intergenic
907975454 1:59427200-59427222 TCCATAGCAGGCACCCAGGACGG + Intronic
908062760 1:60369657-60369679 TGAAGGGCAGGCATCCAGCACGG - Intergenic
908365160 1:63414848-63414870 CACAAGGCAGGCAGTCAGGAGGG + Intronic
909838046 1:80282743-80282765 TGTAGGGCAGTCAGTCAGGAAGG + Intergenic
910232256 1:84998255-84998277 TGAAAGGCAGGGAGCCGGGAGGG + Intergenic
910245339 1:85132712-85132734 TGGAGGGCAGGAAGGCAGGAGGG - Intronic
910604191 1:89065695-89065717 TGCCCAGCACACAGCCAGGAGGG + Intergenic
912387437 1:109278846-109278868 TTCCAGGCAGGGAGCCAGGATGG - Intergenic
912431444 1:109630412-109630434 AGCCCAGCAGGCAGCCAGGCGGG + Intronic
913213893 1:116603923-116603945 CGCACGGCAGGCAGGCCGCAGGG - Exonic
913479758 1:119276701-119276723 TGTAGGGCAGGCACTCAGGAGGG + Intergenic
914348144 1:146817289-146817311 TGCACAGGAGGCAGGCAGCAAGG + Intergenic
914830442 1:151166981-151167003 TGCACGGTGGGCAGTCAGCATGG - Exonic
915259153 1:154663643-154663665 TGAACAGCAGGCAACAAGGAAGG - Intergenic
917305962 1:173624899-173624921 TGCACGGCATGCACTGAGGATGG + Exonic
917707353 1:177647894-177647916 CACAGGGCAGGCAGTCAGGAAGG + Intergenic
917764143 1:178199032-178199054 TGCAGGGCAGCCAGCCTGGCTGG - Intronic
919613544 1:199776893-199776915 AGGAAGGCAGGCAGGCAGGAAGG - Intergenic
920397924 1:205660098-205660120 TGGAGGGCAGGCAGGAAGGAAGG - Intronic
920524902 1:206659358-206659380 TGCAGGTCAGGCATCCAGGCAGG - Intronic
920946496 1:210534073-210534095 TGCATGGCAGCTAGCCAGTATGG - Intronic
922222669 1:223620375-223620397 AGCACTGCAGGCAGACAGAAAGG + Intronic
923117629 1:230958145-230958167 TGCATAGCAGGAAGACAGGATGG - Intronic
923513304 1:234672490-234672512 GCCACGGCAGCCAGCCAGCATGG - Intergenic
923740978 1:236654854-236654876 AGGAAGGCAGGCAGGCAGGAAGG - Intergenic
923740984 1:236654878-236654900 AGGAAGGCAGGCAGGCAGGAAGG - Intergenic
924669677 1:246110812-246110834 TGCACTGCAGCCAGGCAGGATGG - Intronic
1062840199 10:664086-664108 AGCACCGCAGGCACCGAGGACGG + Intronic
1063700653 10:8381318-8381340 TGCACTTCAGGCAGCTTGGAGGG - Intergenic
1064655106 10:17548937-17548959 TGCAGGGCAGGCCGGCAGGCTGG + Intergenic
1065528004 10:26641889-26641911 TCCACTGCAGGCAACCAGGGAGG + Intergenic
1067234534 10:44436837-44436859 TGCACGGGGGCCATCCAGGAAGG - Intergenic
1067428009 10:46223869-46223891 TGCACTGCAGGCTGCCATGGAGG + Intergenic
1067713254 10:48667211-48667233 TGAAGGTCAGGCAGCCAGTAAGG + Intergenic
1068885038 10:62089458-62089480 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
1069183840 10:65397123-65397145 TGCAGGGCAGGCTGGCAGGCTGG + Intergenic
1069824131 10:71244951-71244973 TGCACTGCACGGAGCCAGGCAGG - Intronic
1069888586 10:71639011-71639033 GGACCGGCAGGGAGCCAGGAGGG + Intronic
1070575226 10:77672460-77672482 TCCTCTGCAGACAGCCAGGAAGG + Intergenic
1070593382 10:77816339-77816361 GGCAAGGCAGGGAGCCAAGAGGG - Intronic
1070789094 10:79179086-79179108 TGCAGGCCAGGAACCCAGGATGG + Intronic
1071386406 10:85125735-85125757 GGAACGGCTGGCAGCCAAGATGG + Intergenic
1071394281 10:85206285-85206307 TTCATGGAAGGCAGCCAAGAAGG + Intergenic
1072021996 10:91410949-91410971 TCCAAGGCAGGCAGGCAGGCAGG - Intronic
1072664509 10:97384071-97384093 TCCACCTCCGGCAGCCAGGACGG + Intronic
1073114633 10:101084735-101084757 TGTAGGGCAAGCAGTCAGGAAGG + Intergenic
1073702853 10:105949359-105949381 CACAAGGCAGGCAGGCAGGAAGG - Intergenic
1074065192 10:110007657-110007679 TGCAGGCCCGGCAGCCGGGAGGG - Intronic
1074240361 10:111632664-111632686 TGCACAGCCAGCAGCTAGGAGGG - Intergenic
1075184139 10:120239897-120239919 TGCAAGGCCGGCAGCAAGGCTGG - Intergenic
1075662862 10:124210203-124210225 TTAACAGCAGGCAGCAAGGATGG + Intergenic
1075688425 10:124379544-124379566 TTCACAGCAGGTATCCAGGAAGG + Intergenic
1075705452 10:124497603-124497625 CTGACGGCAGGCAGGCAGGAGGG - Intronic
1076695380 10:132244741-132244763 TGCACGAGGGGCAGGCAGGATGG - Intronic
1076794764 10:132793181-132793203 TGCCCGGCAGGGAGCCAAGAGGG - Intergenic
1076848631 10:133082258-133082280 TGCAGGCCAGGGAGCCAGGCAGG - Intronic
1077108453 11:851813-851835 GGCCCGGCAGGCAGGCAGGCAGG + Intronic
1077171676 11:1169090-1169112 GGCACTGCAGGCAGCGAGGCCGG + Intronic
1077371713 11:2185439-2185461 TGCAGGGGAGGCAGCATGGAGGG + Intergenic
1078006026 11:7532934-7532956 TCCTCAGCAGGCAGCCAGGGAGG + Intronic
1078549499 11:12270434-12270456 TGCAAGGCAGGGAGCTGGGAGGG - Intergenic
1081783921 11:45733102-45733124 TGCACCGAAGGCAGCCAGGTGGG + Intergenic
1083279827 11:61620059-61620081 TGCCCTGGAGACAGCCAGGAGGG - Intergenic
1083510787 11:63208207-63208229 TGCCAGGCAGGCTGCCAGGATGG - Intronic
1084410519 11:69003797-69003819 TGCACACCAGGAACCCAGGATGG + Intergenic
1084589308 11:70080875-70080897 TGCAGGGCAGGCAGCATGGCAGG + Intronic
1084740028 11:71133499-71133521 TGGATGGCAGGCAGACAGGCAGG + Intronic
1084742188 11:71146946-71146968 GGCACGGCAGGGAGCCTGGGGGG + Intronic
1085381224 11:76120741-76120763 ATCACGGCAGGAAGCCAGGCTGG + Intronic
1085408009 11:76275584-76275606 TGCAAGGCATGAGGCCAGGAGGG - Intergenic
1085703215 11:78763580-78763602 TGCAAGGCAGGCATCAAAGAGGG - Intronic
1085775113 11:79358614-79358636 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
1086204464 11:84241191-84241213 TGGAAGGCAGGCAGACAGGCAGG - Intronic
1089784615 11:120898993-120899015 TACACAGCAGGCACCCAGCAAGG - Intronic
1089959245 11:122601024-122601046 GGGAAGGCAGGCAGGCAGGAAGG + Intergenic
1091010094 11:131993234-131993256 TGCATTGCAGTCATCCAGGAGGG + Intronic
1091546108 12:1502288-1502310 TCCAGTGCAAGCAGCCAGGAGGG + Intergenic
1092072090 12:5639687-5639709 AGATGGGCAGGCAGCCAGGAGGG + Intronic
1092178105 12:6424878-6424900 TGCACGGATGGCAGCCAGACTGG + Intergenic
1092853906 12:12655167-12655189 TTCCCAGCAGGCAGTCAGGAAGG - Intergenic
1093536435 12:20229234-20229256 TGCTGGGCAGGCAGGCAGGAAGG - Intergenic
1093779872 12:23122695-23122717 GGAACAGCAGGCAGGCAGGAGGG + Intergenic
1096515210 12:52151962-52151984 TGCACAGCTGGCAGCCAGGCTGG - Intergenic
1096994394 12:55829808-55829830 TGCACCGCAGGAAGCAAGGCAGG + Intronic
1098090686 12:66897566-66897588 TGCATGGGAGGCAGTCATGATGG + Intergenic
1098844163 12:75515159-75515181 TGCACGGTAGGCTGGCAGGCTGG - Intergenic
1100102808 12:91130148-91130170 AGGAAGGCAGGCAGGCAGGAAGG - Intergenic
1101179836 12:102203691-102203713 CACAGGGCAGGCTGCCAGGAAGG - Intergenic
1102405656 12:112672123-112672145 TGCAGGGCAGGCAGACAGGCAGG + Intronic
1102922078 12:116799152-116799174 TGGATGGCAGCCAGCAAGGATGG - Intronic
1103614053 12:122141169-122141191 TCCACTGCAGGCAGCCAGGTGGG + Intronic
1103971336 12:124674542-124674564 TGCCTGGCAGGCAGGCAGGCGGG + Intergenic
1104231258 12:126886569-126886591 TGCAGGGCAGGCTGTCAGAAAGG + Intergenic
1104349930 12:128036124-128036146 TGCAGGGCAGGGAGGCAGGGAGG + Intergenic
1104849375 12:131864043-131864065 TGCCCGACAGACAGCCAGGGTGG - Intergenic
1105214334 13:18275403-18275425 TCCATGGCAGTCAGCCGGGAGGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106428872 13:29659966-29659988 AGGAAGGCAGGCAGGCAGGAAGG + Intergenic
1106467001 13:30022494-30022516 TGCTCTGCAGGCTGCTAGGAGGG + Intergenic
1106480711 13:30135172-30135194 TGCAGGGCAGGCAACCAGCCTGG + Intergenic
1106976180 13:35219184-35219206 GGCAAGGCAGGAAGGCAGGAAGG - Intronic
1107241908 13:38245834-38245856 TGCATGGCAGACACCAAGGAAGG - Intergenic
1107609845 13:42102271-42102293 TGCTCTGCAGCCAGCCAGGCAGG - Intronic
1108572431 13:51764811-51764833 TGCACGGCCCGCAACCAGGAAGG + Exonic
1109122783 13:58479041-58479063 TGCAGGGTAGGCAGGCAGGTTGG - Intergenic
1109203808 13:59459740-59459762 TGCTGGGCAGGCAGTCTGGAAGG + Intergenic
1113484605 13:110645116-110645138 CGCACTGAAGGCAGCCAGGCCGG - Intronic
1113612328 13:111656011-111656033 TGCTCGGGAGGCTCCCAGGAGGG + Intronic
1113777792 13:112958616-112958638 TGCCAGGCAGGTGGCCAGGAAGG - Intronic
1114547234 14:23512089-23512111 TACAGGGCAGGCTGCCAGGCTGG - Intergenic
1114690363 14:24574863-24574885 TGCAGGGTAGGCAGACAGCACGG + Intronic
1114719563 14:24866262-24866284 TGCAAGGCAGGCTGGCAGGTTGG - Intronic
1116051187 14:39805164-39805186 TCCAAGACAGGCAGGCAGGAAGG - Intergenic
1116973396 14:51092603-51092625 TGCAGGGCAGGGATTCAGGATGG - Intronic
1117650864 14:57903541-57903563 TGCAGGGCAGGCAGTTGGGAAGG - Intronic
1118817250 14:69322277-69322299 TGCAGCACAGGCAGACAGGAGGG - Intronic
1119159088 14:72438327-72438349 TGCACTTCAGGCAGCGAGGCTGG - Intronic
1120964934 14:90158688-90158710 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
1120974448 14:90236305-90236327 AGGAAGGCAGGCAGGCAGGAAGG - Intergenic
1121161566 14:91746207-91746229 TGTAGGGCAGGCAGTCAGAAAGG - Intronic
1122409204 14:101517503-101517525 AGCAAGGCATGCAGCCAGGGTGG - Intergenic
1122410026 14:101521216-101521238 GCCAGGCCAGGCAGCCAGGAAGG - Intergenic
1122945315 14:105005980-105006002 CCCACAGCAGGCAGCCAGGATGG + Intronic
1123994025 15:25705881-25705903 TGCACGGCTGGCACCCATGTGGG + Intronic
1124360364 15:29032448-29032470 TGCAGGGCAGGCCGGCAGGCTGG - Intronic
1127209805 15:56761832-56761854 TGCAGGGCAGGCCGGCAGGCTGG - Intronic
1128248487 15:66149015-66149037 GGCAGGGCAGACACCCAGGACGG + Intronic
1128677814 15:69624659-69624681 GGGAAGGCAGGCAGGCAGGAAGG - Intergenic
1130168014 15:81483087-81483109 TGCAAGGTAGGCAGGCAGGCTGG + Intergenic
1130292330 15:82613891-82613913 AGCCCGGGAGGCTGCCAGGAAGG + Intronic
1130705914 15:86232801-86232823 TGCAGGGCGGGGAGGCAGGAGGG - Intronic
1130789351 15:87135755-87135777 TGCAGGGCAGGCTGGCAGGCTGG + Intergenic
1131072462 15:89474841-89474863 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
1131072480 15:89474913-89474935 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
1131072535 15:89475157-89475179 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
1131072539 15:89475173-89475195 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
1131079087 15:89519324-89519346 TGGGCTGCATGCAGCCAGGATGG + Intergenic
1132297500 15:100751673-100751695 TGCAGGGCAGGCTGACAGGCTGG + Intergenic
1132666087 16:1081963-1081985 TGCAGGGCCGGCAGCCACGAGGG + Intergenic
1132709839 16:1261508-1261530 AGCAGGGCAGGCAGGCAGGGCGG + Intergenic
1132771428 16:1565594-1565616 TGCAGGGCAGGAAAGCAGGACGG - Intronic
1133914759 16:10099459-10099481 TGCAAGGGAGGGAGACAGGATGG - Intronic
1134023800 16:10939963-10939985 TGGATGGCAGGCAGGCAGGCAGG + Intronic
1136186490 16:28591566-28591588 TGTGGGGCAGGCAGACAGGAGGG - Intronic
1136188975 16:28604290-28604312 TGTGGGGCAGGCAGACAGGAGGG - Intergenic
1137335718 16:47546825-47546847 TGCACGGCAGCAAGCCTGGCTGG - Intronic
1137673652 16:50293218-50293240 GGCAGGGCAGGCAGGCAGGGAGG + Intronic
1137755887 16:50901828-50901850 GGGAAGGCAGGCAGGCAGGAAGG + Intergenic
1139483028 16:67241189-67241211 GGGAGGGCAGGCAGCCAGGCAGG - Intronic
1139949076 16:70660527-70660549 TGCAGGGGAGACAGCCAGCACGG + Exonic
1139985893 16:70898256-70898278 TGCACAGGAGGCAGGCAGCAAGG - Intronic
1141160464 16:81626039-81626061 GCCAGGGCAGGCAGCCAGAAAGG - Intronic
1141647741 16:85376537-85376559 CGCCCGGCAGGCAGGCAGGGAGG - Intergenic
1141665707 16:85464102-85464124 GGCAGGCGAGGCAGCCAGGAGGG - Intergenic
1141674086 16:85508489-85508511 TGGAGGGTAGGGAGCCAGGAGGG + Intergenic
1141980119 16:87545004-87545026 TGCAGGGCAGGGTCCCAGGATGG + Intergenic
1142006328 16:87691108-87691130 TCCAGGGCAGGCAGCTTGGAGGG + Intronic
1143118929 17:4595540-4595562 TGTGAGGCAGGGAGCCAGGAAGG + Intronic
1143203343 17:5127086-5127108 TGCAGGGCAGGAAGCCAGCCAGG - Intronic
1143518582 17:7432487-7432509 TGGCGGGCAGGCAGCCAGCACGG + Intergenic
1143785727 17:9254186-9254208 GGCACCGGAGACAGCCAGGATGG - Intronic
1144347151 17:14359669-14359691 TGTAAGGGAGGCAGCCAGGGAGG - Intergenic
1144874510 17:18390412-18390434 TGCAGGGCAGGAAGCCAGCCAGG - Intergenic
1145392824 17:22469291-22469313 TGCACCGCAGGGAGGAAGGATGG + Intergenic
1146307381 17:31740977-31740999 TAAATGGCAGGCAGCCTGGAGGG + Intergenic
1146452249 17:32983817-32983839 TGGAAGGCAGGCAGGCAGGCAGG + Intronic
1146581280 17:34040382-34040404 TGCACGGCTGGGAGGCAGGGGGG + Intronic
1147169048 17:38607463-38607485 TCCTGGGCAGGCAGCCAGGCAGG - Intergenic
1147188249 17:38724548-38724570 GGCAGGGCAGGCAGGCAGCAGGG + Intronic
1148144548 17:45354724-45354746 AGGAAGGCAGGCAGGCAGGAGGG - Intergenic
1148915499 17:50973854-50973876 TGCAGGGCAGGCTGGCAGGCTGG - Intronic
1150627390 17:66850140-66850162 TGCAGGGCAGGAAGACAGGCTGG - Intronic
1150984309 17:70177959-70177981 AGCAAGGCAGTCAGCCAGGCAGG - Exonic
1151555722 17:74845820-74845842 TGAAGGGCAGGAAGACAGGAAGG - Intronic
1151869803 17:76828571-76828593 GGGAAGGCAGGCAGCCAGCAGGG + Intergenic
1152211626 17:79005442-79005464 TGGACAGCAGACAGCCAAGAGGG + Intronic
1152859514 17:82687733-82687755 TGATCGGCAGCCAGTCAGGAGGG - Intronic
1153764396 18:8361793-8361815 AGCCTGGCAGGCAGGCAGGAGGG - Intronic
1156064362 18:33121353-33121375 TGTAAGGCAGGCAATCAGGAAGG - Intronic
1156504151 18:37578234-37578256 TGCACCACAGGCAGCTAGGATGG + Intergenic
1157761665 18:50269794-50269816 TGCAGGGCAGGCACTCGGGAAGG - Exonic
1157826598 18:50818009-50818031 GGCACTGCAGGCAGGAAGGAGGG - Intronic
1159927567 18:74282521-74282543 TGCACAGCAGGCGGGCAGGCAGG + Intronic
1160137370 18:76283907-76283929 CGTAGGGCAGGCAGTCAGGAAGG + Intergenic
1160437602 18:78863280-78863302 TGGACGGCAAGGAGCCAGGAGGG - Intergenic
1160449661 18:78953709-78953731 GGCACGGCAGACAGAGAGGAAGG - Intergenic
1160896111 19:1402597-1402619 CGCACGGCAGGCAGGCAGGCAGG - Intergenic
1161260551 19:3335532-3335554 GGGACAGCAGGCAGCCAGGCTGG + Intergenic
1161299025 19:3533973-3533995 TGCACTTCAGGAAGCCAGGGTGG + Intronic
1161299479 19:3535933-3535955 TGCACAGCAGGCAGGGAGGGAGG + Intronic
1161552772 19:4923343-4923365 TGGAGAGCAGGCAGCCAGCAGGG - Intronic
1162156038 19:8678587-8678609 TGCAAGGAAGGAAGACAGGATGG - Intergenic
1163306637 19:16483833-16483855 TGCATGGCTGGTAGCCACGATGG - Intronic
1164921466 19:32091668-32091690 TGTACGGCAGCCAGGCTGGAAGG + Intergenic
1165227644 19:34365793-34365815 TGCAGGGCGGGCAGCCCGGGCGG + Intronic
1166651844 19:44580882-44580904 TATACAGCAGGAAGCCAGGAGGG - Intergenic
1167555004 19:50189065-50189087 GGCAAGGCAGGAAGGCAGGATGG - Intronic
1167736664 19:51298580-51298602 TGTAGGGCAGGCAGGCAGGAGGG + Intergenic
1168184203 19:54687455-54687477 TGCACTAAAGGCAGCCTGGAAGG - Intronic
925114441 2:1366656-1366678 AGCACGGCGGGAAGCGAGGAGGG - Intronic
925532827 2:4883648-4883670 TGCACAGCAGGGGGCCAGCATGG + Intergenic
925628705 2:5867286-5867308 TGCGTGGGAGGCAGCGAGGAGGG + Intergenic
925792857 2:7510564-7510586 TGCCTGGCAGGCAGCCTGCAGGG + Intergenic
926110944 2:10183463-10183485 GGAGGGGCAGGCAGCCAGGAGGG - Intronic
927233483 2:20848324-20848346 TGCAAGATAGGCAGCCAGGTTGG - Intergenic
927747259 2:25634045-25634067 TCTACGCCCGGCAGCCAGGAGGG + Intronic
928259098 2:29750694-29750716 AGGAAGGCAGGCAGGCAGGAAGG + Intronic
929666985 2:43840827-43840849 TGCAATGCAGGTAGGCAGGAGGG - Intronic
929791441 2:45025873-45025895 TGCATAGCAGGCATGCAGGATGG + Intergenic
930344474 2:50161843-50161865 AGGAAGGCAGGCAGGCAGGAAGG + Intronic
931894559 2:66714475-66714497 TGTAGGGCAGGCAGGCAGGCTGG - Intergenic
933849708 2:86356144-86356166 CCCAGGGCAGGCAGTCAGGAAGG + Intergenic
934299985 2:91771338-91771360 TCCATGGCAGTCAGCCGGGAGGG - Intergenic
934919280 2:98329883-98329905 TGTGGGGCAGGCAGTCAGGAAGG - Intergenic
936348735 2:111696416-111696438 TGCAAGGTAGGCTGCCAGGCTGG + Intergenic
936640223 2:114303850-114303872 TTCAGGGCTGGCAGGCAGGAAGG + Intergenic
936683194 2:114798608-114798630 TGCAGTGCTGGAAGCCAGGAGGG + Intronic
937072205 2:119073109-119073131 TGGAAGGCAGGCAGGAAGGAGGG + Intergenic
938408255 2:131044597-131044619 TGACCGGCAGGCGGCCAGGCAGG - Intronic
938748214 2:134301713-134301735 CACAGGGCAGGCAGCTAGGAAGG + Intronic
939176725 2:138757587-138757609 CACAGGGCAGGCAGTCAGGAAGG - Intronic
939225064 2:139354141-139354163 TGCCTGGAATGCAGCCAGGAGGG + Intergenic
939444846 2:142295688-142295710 AGGAAGGCAGGCAGGCAGGAAGG - Intergenic
940473889 2:154135178-154135200 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
940903531 2:159147873-159147895 TGCAAGTCATGCACCCAGGATGG - Intronic
941420578 2:165278969-165278991 AGAAAGGCAGGCAGGCAGGAAGG + Intronic
942944408 2:181657121-181657143 CGCAGGGCAGGGACCCAGGAGGG + Intronic
943720209 2:191196370-191196392 TGGAAGGCAGGAAGGCAGGAAGG + Intergenic
943851525 2:192729431-192729453 AGGAAGGCAGGCAGGCAGGAAGG + Intergenic
944580258 2:201125959-201125981 TGCAGGGCTGGCAGTCAGGAGGG + Intronic
946125027 2:217555187-217555209 TGCAAGGCAGGCAGGCAGGCAGG + Intronic
946399571 2:219461315-219461337 TGCACGGCAGGAAGCTGAGAAGG + Intronic
947134981 2:226968334-226968356 TGTAGGGCAGGCCGTCAGGAAGG + Intronic
947471422 2:230404543-230404565 TGGAAGGCAGACAGCAAGGAAGG + Intergenic
947899318 2:233707170-233707192 CGGAGGGCAGGCACCCAGGATGG - Intronic
948004715 2:234597564-234597586 TGCACTCCTGTCAGCCAGGATGG + Intergenic
948184903 2:236013531-236013553 CGCAAAGCAGGCAGCCAGGCTGG - Intronic
1168818063 20:754451-754473 AGCACAGCAGGGAGCCAGGGTGG + Intergenic
1169001472 20:2171041-2171063 TGCAAGGCAAGCAGGCAGGCAGG + Intronic
1169488445 20:6052574-6052596 TGCGCGGTAGGCAGCCGGGCAGG + Exonic
1170586426 20:17737851-17737873 TTGACGGCAGGAAGCCAGCATGG - Intergenic
1170613230 20:17930349-17930371 GGCTGGGCAGGCAGCCAGCAGGG - Intergenic
1170912721 20:20590816-20590838 TGGAAGGCAGGGAGGCAGGATGG - Intronic
1170999424 20:21397400-21397422 GGCTCGGCGGGCAGCCAGGTAGG + Exonic
1172020813 20:31912706-31912728 TGCAGGGCAGGCCAGCAGGATGG + Intronic
1172511549 20:35504377-35504399 TGCCTGGCAGGCATCCAGGGAGG - Exonic
1173130625 20:40389688-40389710 TCCATGGCAGGCAGTCAGGAAGG + Intergenic
1173470552 20:43320340-43320362 TGCAGGGCAGGGTCCCAGGATGG - Intergenic
1173828624 20:46063561-46063583 TGCCAGACAGGCAGCCAAGATGG - Exonic
1174290985 20:49508355-49508377 TGCATGGCTGCCAGGCAGGAGGG - Intronic
1174952322 20:55055868-55055890 GGAAAGGCAGGCAGGCAGGAAGG - Intergenic
1175317411 20:58058664-58058686 TGCACAGCAGGCTACCAGGATGG + Intergenic
1175407764 20:58745820-58745842 GGCAAGGCAGGCAGGGAGGAGGG + Intergenic
1175419437 20:58822100-58822122 AGGAAGGCAGGCAGCCATGATGG + Intergenic
1176031989 20:63017216-63017238 CACCCGGGAGGCAGCCAGGAGGG + Intergenic
1176163172 20:63658849-63658871 TGGACTCCAGCCAGCCAGGAGGG + Intronic
1176200446 20:63858005-63858027 GGCCCTGCAGGGAGCCAGGACGG + Intergenic
1179043903 21:37828854-37828876 TGCAGGGTAGACAGCCTGGAGGG - Intronic
1179181887 21:39052784-39052806 TGCAGGGCAGGCTGGCAGGCTGG + Intergenic
1179799067 21:43802499-43802521 TGGATAGCAGGCACCCAGGATGG - Intronic
1180948470 22:19709569-19709591 TCCACGGCAGGGAGCCAGCCTGG - Intergenic
1181556043 22:23672185-23672207 TCCATGGCAGTCAGCCATGAGGG + Intergenic
1181623467 22:24106459-24106481 GGCAGGGCAGGCAGCAGGGAGGG - Intronic
1181698336 22:24606468-24606490 TCCATGGCAGTCAGCCAGGAGGG - Intronic
1182486816 22:30644022-30644044 TGCAAGGCAGCCAGGCAGGAAGG - Intronic
1183593265 22:38794033-38794055 GGCGCGGCGGGCAGCCAGGCGGG - Intronic
1183676915 22:39304326-39304348 TGCAGGCCTGGCAGCCAGCAGGG - Intergenic
1184096221 22:42317894-42317916 TGCACGGCAGGCAGCCAGGAGGG - Intronic
1184321815 22:43747676-43747698 TGAACAGAAGGCAGGCAGGAGGG - Intronic
1184607362 22:45581823-45581845 TGAGAGGCAGGGAGCCAGGAAGG + Intronic
1184716885 22:46287575-46287597 TGCTCTGCAGGTAGCCTGGAGGG + Intronic
1185174122 22:49310170-49310192 TGCACGGAAGGAAGGAAGGAAGG + Intergenic
949593556 3:5519132-5519154 TGCATGGCAGTCAGGCAGGAAGG - Intergenic
949731871 3:7123296-7123318 TGCACAGAAGCCAGTCAGGATGG - Intronic
950445093 3:13032468-13032490 TGCACTGCACGGAGCCAGGTTGG + Intronic
950541915 3:13617948-13617970 TGCCCAGCAGACAGCAAGGATGG - Intronic
950569350 3:13790617-13790639 TGCAGGGCAGGCAGTGTGGAGGG - Intergenic
951193556 3:19798580-19798602 AGGAAGGCAGGCAGGCAGGAAGG + Intergenic
953653836 3:44832218-44832240 AGCACAGCAGGCAGTCAGGGTGG + Intronic
953769268 3:45766154-45766176 TGGTCAGCAGGCAACCAGGAGGG + Intronic
954539462 3:51384332-51384354 TTGAAGGCAGGCAGCCAGGAGGG + Intergenic
954704428 3:52471642-52471664 TGCCTAGCAGGCACCCAGGAGGG + Intronic
959108922 3:102098353-102098375 TGCAGGGCTGGCAGTCATGAGGG + Intergenic
960134282 3:114089972-114089994 TGTAGGGCAGGGAGCCTGGAAGG + Intergenic
960386096 3:117023725-117023747 CGGCCGGCAGGCAGGCAGGAAGG - Intronic
960678587 3:120222952-120222974 TACAAGGCAGGCAGTCAGGAGGG + Intronic
960972865 3:123151788-123151810 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
960972875 3:123151828-123151850 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
961560039 3:127722376-127722398 TGCAAGGCTGGAAGCCAGGGTGG + Intronic
961738990 3:129020781-129020803 TCCAGGGGAGGGAGCCAGGAAGG + Intronic
962274811 3:134004007-134004029 CACAGGGCAGGCAGTCAGGAAGG - Intronic
962375015 3:134852062-134852084 TGCACAGCCGACTGCCAGGAGGG - Intronic
962474070 3:135740365-135740387 CGCAGGGCAGGCTGCGAGGAAGG + Intergenic
965458163 3:168929800-168929822 TGCCCAGCAGGGACCCAGGAGGG + Intergenic
966548330 3:181176822-181176844 TGCATGGCAGCCTGCCAAGACGG + Intergenic
966928568 3:184661173-184661195 TGCATGCCAGGCAGGCAGGAGGG + Intronic
967156055 3:186693402-186693424 TTCTGGGCACGCAGCCAGGAAGG - Intergenic
967593730 3:191306916-191306938 TCCACTGCACCCAGCCAGGAGGG + Intronic
967633121 3:191770406-191770428 TGAAGGGCAAGCAGTCAGGAAGG + Intergenic
967685522 3:192411275-192411297 TGCCCAGCTGGCAGCCTGGAAGG - Intronic
968002827 3:195219471-195219493 TTCAGGGCAGGCAGGCAGGAAGG + Intronic
968609088 4:1549043-1549065 TGCACTGCAGGCAGCCCAGAGGG + Intergenic
968833487 4:2945891-2945913 TGCACGGCAGCGAGCCTGGGAGG - Intronic
968960694 4:3741910-3741932 CGCACGGCAGGCTGGCAGGCTGG - Intergenic
970913664 4:21307904-21307926 TACAAGGAAGGCAGCCAAGAAGG + Intronic
971193725 4:24452151-24452173 TGCATGGCAGGCTGGCAGGTTGG - Intergenic
973838134 4:54831627-54831649 TGCAGGGCAGGAATTCAGGAAGG + Intergenic
975327886 4:73080641-73080663 GTCAGGGCAGGCAGGCAGGAAGG + Intronic
977470274 4:97434802-97434824 GGCCAGGCAGGCAGGCAGGAAGG + Intronic
978328924 4:107590260-107590282 TGCACCCCAGGCAGCAGGGAAGG + Intronic
978952198 4:114574312-114574334 AGGAAGGCAGGCAGGCAGGAAGG - Intergenic
979673424 4:123385071-123385093 TGCACTGAAGGAAGCAAGGATGG - Intergenic
979918420 4:126469104-126469126 AGGAAGGCAGGCAGGCAGGAAGG + Intergenic
981081847 4:140644480-140644502 CGCAGGGCCGGCAGCCAGGCGGG + Intronic
981262886 4:142743356-142743378 TGCAAGGCAAGAAGCCAGAAAGG + Intronic
982758343 4:159251114-159251136 TGCAGGGCGGGCAGGCAGGCGGG - Intronic
986180223 5:5386086-5386108 AGAACGGGAGGCAGGCAGGAGGG + Intergenic
986724171 5:10581827-10581849 TACAGGGCAGGCAGGCAGGCTGG - Intronic
986832168 5:11592151-11592173 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
986832172 5:11592167-11592189 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
986832176 5:11592183-11592205 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
986832184 5:11592223-11592245 AGGAAGGCAGGCAGGCAGGAAGG - Intronic
987661537 5:20884554-20884576 TGTACAGCAGGCAGGCAGGCTGG - Intergenic
988762044 5:34320761-34320783 TGTACAGCAGGCAGGCAGGCTGG + Intergenic
988913581 5:35870296-35870318 TGCAAGGCAGGAAGGCAGTAGGG + Intronic
989123632 5:38029711-38029733 TGCAAGGGAGCCAGCCAGGATGG - Intergenic
989308859 5:39989162-39989184 TGCACAGAAGGCATGCAGGAGGG + Intergenic
989609533 5:43277956-43277978 TGGAAGGCAGGCAGGAAGGAAGG - Intronic
990003799 5:50922802-50922824 TGCACTGCAGGCAGCCCAGAGGG - Intergenic
992755545 5:79902291-79902313 TGCAGGGAGGGCAGCCAAGATGG + Intergenic
993487267 5:88502302-88502324 TGCACTGCAGGATGCCATGAAGG + Intergenic
994130329 5:96219743-96219765 AGGAAGGCAGGCAGGCAGGAAGG + Intergenic
994318784 5:98365303-98365325 TGCAAGGCAGGAAGAAAGGAGGG - Intergenic
995358744 5:111269483-111269505 TGCACAGCAAGGACCCAGGAAGG - Intronic
996836944 5:127804021-127804043 GGCATGGGAGGCACCCAGGACGG + Intergenic
997302956 5:132819800-132819822 ACCGCGGCAGGCAGCCAGGAAGG + Intergenic
997582767 5:135027917-135027939 TGCACGGCGGGCGGTGAGGAGGG + Exonic
998322928 5:141249271-141249293 TGTACAGCAGGCAGTTAGGAGGG - Intergenic
998515624 5:142751245-142751267 TGTAGGCCAGGAAGCCAGGAAGG + Intergenic
999845529 5:155475416-155475438 TGCACTACACTCAGCCAGGAGGG + Intergenic
999934229 5:156468099-156468121 AGCACTTCAGGCAGCCAAGATGG + Intronic
1000326718 5:160177894-160177916 TGCACAGCTGGGAGACAGGAAGG - Intergenic
1000379649 5:160617235-160617257 TGCAAGGCAGGCAGGCAGTGAGG - Intronic
1001403899 5:171462349-171462371 AGCTGGGCAGGCAGGCAGGAGGG - Intergenic
1001568708 5:172716542-172716564 GGCACAGCAGGCTCCCAGGAAGG - Intergenic
1002167108 5:177354874-177354896 TGCCCTGTGGGCAGCCAGGAAGG + Intergenic
1002297064 5:178237668-178237690 TGGAAGGCAAGCAGCCAGGATGG + Exonic
1003143851 6:3493468-3493490 TGCTCTGCAGGCTGCAAGGACGG + Intergenic
1003312894 6:4984915-4984937 AGCCCAGCAGGAAGCCAGGAAGG - Intergenic
1004662085 6:17719575-17719597 TGCATGGAAGGCACCCAGCAAGG - Intergenic
1004714458 6:18203967-18203989 TGCACAGCAGGAAGCGGGGATGG + Intronic
1007662597 6:43495931-43495953 TGAACGGCAGGCAGGCAGGGAGG - Intronic
1007696525 6:43737402-43737424 CCCACGCCAGGCAGCCTGGACGG - Intergenic
1009452464 6:63817783-63817805 TGCAGGGCAGGCGGCAAGCAAGG - Intronic
1009718209 6:67428003-67428025 TTCACAGCCGGCAGGCAGGAAGG + Intergenic
1010054140 6:71544289-71544311 TGCAAAGCATGCAGCCAGGAAGG + Intergenic
1010800471 6:80168697-80168719 AGAAAGGCAGGCAGGCAGGAAGG + Intronic
1012802130 6:103843714-103843736 TGCACTGCAGACAGCAAGGTAGG + Intergenic
1013787316 6:113796233-113796255 CACAGAGCAGGCAGCCAGGAAGG - Intergenic
1014348829 6:120313071-120313093 TGCAGGGCAGGCTATCAGGAAGG - Intergenic
1015465560 6:133544579-133544601 TGAGCGGCAGGCAGGCAGGCAGG + Intergenic
1018688441 6:166322290-166322312 TGCACGCCAGGCAGCAGGGCGGG + Intronic
1019316383 7:388858-388880 TCCCGGGCAGGGAGCCAGGAGGG + Intergenic
1020081663 7:5289441-5289463 AGCCAGGCAGGCAGTCAGGAAGG + Intronic
1020447930 7:8288849-8288871 AACACAGCAGGAAGCCAGGAAGG - Intergenic
1021194981 7:17665113-17665135 GGCTGGGCAGGGAGCCAGGAGGG - Intergenic
1022420143 7:30212418-30212440 TGCACGGCTGGGTGACAGGATGG + Intergenic
1022484132 7:30764993-30765015 TGCAAGGCAGGCTGGCAGGTTGG + Intronic
1023595136 7:41821802-41821824 AGGAAGGCAGGCAGGCAGGAAGG + Intergenic
1024253634 7:47523986-47524008 TGCACTGCAGGCACCCAGGCTGG + Intronic
1024529586 7:50380335-50380357 AGCAGGGCAGGCAGGCAGGCGGG - Intronic
1024565328 7:50675650-50675672 TGCAGGGCAGGCTGGCAGGCTGG - Intronic
1024730316 7:52246538-52246560 TGCAGGGCAGGCTGGCAGGCTGG + Intergenic
1024774099 7:52762324-52762346 CGGAAGGCAGGCAGGCAGGAAGG - Intergenic
1024965860 7:55021230-55021252 GGCACCCCAGGCAGGCAGGACGG - Intronic
1025080566 7:55978702-55978724 TTCAGGACAGGCAGTCAGGAAGG - Intronic
1025197240 7:56942713-56942735 AGCCAGGCAGGCAGTCAGGAAGG - Intergenic
1025674709 7:63634226-63634248 AGCCAGGCAGGCAGTCAGGAAGG + Intergenic
1026296077 7:69053421-69053443 TGGCAGGCAGGCAGGCAGGAAGG + Intergenic
1026331184 7:69353957-69353979 TGCACCACAGGCAGTGAGGAGGG - Intergenic
1027241609 7:76333768-76333790 TGCACTGGAGGCAGTCATGAGGG - Intronic
1029244828 7:99191452-99191474 TCTACGGCAGGCAACCAGAAGGG + Intronic
1029274118 7:99394131-99394153 GGCATGGCGGGAAGCCAGGAGGG - Intronic
1030110309 7:106021283-106021305 GGCACAGCAGGCAGCAGGGATGG - Intronic
1031523759 7:122798852-122798874 TGCAAGACAGGGAGTCAGGAGGG + Intronic
1032037511 7:128531294-128531316 TGCACGGCTGGGAGGCAGGGGGG - Intergenic
1032362832 7:131272105-131272127 TCCAGAGCTGGCAGCCAGGAAGG - Intronic
1032738136 7:134711545-134711567 TGCGCAGCAGGCAGACAGGCTGG - Intergenic
1032908112 7:136396106-136396128 AGGAAGGCAGGCAGGCAGGAAGG + Intergenic
1033236541 7:139642417-139642439 TGCACAGAAGACAGCCAGAAAGG + Intronic
1034319235 7:150164242-150164264 AGCCCGGCAGGCAGGCAGGGTGG - Intergenic
1034740806 7:153471728-153471750 TGCACGGCAGCGAGGCATGAGGG + Intergenic
1034773525 7:153802966-153802988 AGCCCGGCAGGCAGGCAGGGTGG + Intergenic
1034946477 7:155265678-155265700 GGCACTGCTGGCAGCCAGGAGGG - Intergenic
1035254354 7:157616616-157616638 TGAAGGGAAGGCAGCCAGGCTGG + Exonic
1035602321 8:903942-903964 TGCACGGGAGGCATCAGGGAGGG + Intergenic
1035748573 8:1979161-1979183 TGCAGGGCAGGCCGGCAGGCTGG + Intronic
1036508457 8:9378415-9378437 AGGAAGGCAGGCAGGCAGGAAGG + Intergenic
1038245206 8:25848746-25848768 TGGACGGGAGGCAGACAGGATGG - Intronic
1039456160 8:37708539-37708561 TGTAGGGCAGGCAGACAGGAAGG + Intergenic
1040901260 8:52419332-52419354 TGCAGGGCAGGCTGGCAGGCTGG - Intronic
1041931758 8:63295054-63295076 TGCACTGCAACCAGCCTGGAAGG - Intergenic
1041981511 8:63866475-63866497 TGCACATCAGGGAGGCAGGAAGG + Intergenic
1042295559 8:67213820-67213842 TGTAGGGCAGGCAGGCAGGCTGG - Intronic
1042701902 8:71624786-71624808 TGTACGGCAGGCTGGCAGGAAGG + Intergenic
1043766256 8:84135793-84135815 AGGAAGGCAGGCAGGCAGGAAGG + Intergenic
1046256300 8:111700620-111700642 TGTATAGCAGGAAGCCAGGAAGG - Intergenic
1046589531 8:116189353-116189375 GGCACTGCAGACAGCCAGTATGG - Intergenic
1048251473 8:132869794-132869816 TGGGCAGCAGGCAGCCAGGACGG + Exonic
1049251140 8:141589621-141589643 TGCAGGGCAGACAGCCAGTGGGG + Intergenic
1049783497 8:144439611-144439633 TGCACGGAGGGCAGGCATGAGGG - Intronic
1050118757 9:2287212-2287234 TGCCCTGCAGGTAGCCAGGCGGG - Intergenic
1051934473 9:22429408-22429430 TGAATGGCAAGGAGCCAGGAAGG + Intergenic
1053133046 9:35629613-35629635 TGCAGGCCAGGCAGCCAGGAAGG + Intronic
1053311895 9:37025703-37025725 TGCGGGCCAGGCAGCCAGGCCGG + Intronic
1053470848 9:38345381-38345403 TGTAGTGCAGGCAGCAAGGAGGG - Intergenic
1053472881 9:38359369-38359391 TGCATGGGAGGGAGGCAGGATGG + Intergenic
1055058371 9:72044312-72044334 TGCAGGGTAGGCAGACAGGTTGG + Intergenic
1055270850 9:74556752-74556774 TGGGGAGCAGGCAGCCAGGATGG + Intronic
1055462217 9:76529788-76529810 TGTGCTGCAGGCACCCAGGAAGG - Intergenic
1056840124 9:89992162-89992184 TCCGCAGGAGGCAGCCAGGAGGG + Intergenic
1057531691 9:95853199-95853221 TGCACGGCAGTCTAACAGGAAGG - Intergenic
1058001541 9:99870790-99870812 TGGAGGCCAGGCTGCCAGGAAGG - Intergenic
1060174157 9:121485272-121485294 TACAAGGCAGGCAGACAGAATGG + Intergenic
1060975575 9:127763004-127763026 TGCAAGGGAGACAGCCTGGAGGG - Intronic
1061234493 9:129334598-129334620 TGCCCGGCAGGCAGCCCAGCCGG - Intergenic
1061553295 9:131350232-131350254 TGCAAGGCTGACAGGCAGGAAGG + Intergenic
1061702263 9:132424770-132424792 TGCCGGCCAGGGAGCCAGGATGG + Intronic
1062494881 9:136827000-136827022 GGCACAGCAGGCCACCAGGAAGG - Intronic
1062592572 9:137280845-137280867 TCCACGGGAGGCGTCCAGGAGGG - Exonic
1186618670 X:11215131-11215153 TGCTGGGCAGCCAGGCAGGAGGG - Intronic
1187385331 X:18843335-18843357 TACAGGGCAGGTAGTCAGGAAGG - Intergenic
1187793620 X:22977725-22977747 AGAAAGGCAGGCAGGCAGGAAGG + Intergenic
1188263953 X:28047005-28047027 TGTAAGGCAGGAAGTCAGGAAGG - Intergenic
1188515530 X:30981582-30981604 AGCAAGGCAGGCAGCTAGGAAGG + Intergenic
1189159243 X:38793803-38793825 AGCAAGGCAGGCAGGCAGGAAGG + Intergenic
1189492648 X:41481998-41482020 TGGAAGGCAGGCAGGCAGGTGGG - Intergenic
1190433942 X:50404890-50404912 TGCTCACCTGGCAGCCAGGAAGG - Intronic
1192271850 X:69588296-69588318 TATACGGCAGTCAGTCAGGAAGG - Intergenic
1198316110 X:135468161-135468183 GGTATGGCAGGCAGTCAGGAAGG - Intergenic
1199574786 X:149303079-149303101 TGCAGAGCAGGCAGCCAGAAAGG - Intergenic
1200230042 X:154439308-154439330 TGCACGGCTGGCTGCCAGGAGGG + Intronic
1201060357 Y:10038664-10038686 GGCAGGGAAGGGAGCCAGGAAGG - Intergenic
1202152688 Y:21857515-21857537 TGCACAGCAGGCACCCATAAAGG - Intergenic