ID: 1184096232

View in Genome Browser
Species Human (GRCh38)
Location 22:42317930-42317952
Sequence GTGTGGCCAATGGGGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184096232_1184096239 -5 Left 1184096232 22:42317930-42317952 CCTGGCAGCCCCATTGGCCACAC No data
Right 1184096239 22:42317948-42317970 CACACTCCCAGAGCCCTATGGGG No data
1184096232_1184096238 -6 Left 1184096232 22:42317930-42317952 CCTGGCAGCCCCATTGGCCACAC No data
Right 1184096238 22:42317947-42317969 CCACACTCCCAGAGCCCTATGGG No data
1184096232_1184096243 3 Left 1184096232 22:42317930-42317952 CCTGGCAGCCCCATTGGCCACAC No data
Right 1184096243 22:42317956-42317978 CAGAGCCCTATGGGGCAGGCAGG No data
1184096232_1184096236 -7 Left 1184096232 22:42317930-42317952 CCTGGCAGCCCCATTGGCCACAC No data
Right 1184096236 22:42317946-42317968 GCCACACTCCCAGAGCCCTATGG No data
1184096232_1184096240 -1 Left 1184096232 22:42317930-42317952 CCTGGCAGCCCCATTGGCCACAC No data
Right 1184096240 22:42317952-42317974 CTCCCAGAGCCCTATGGGGCAGG No data
1184096232_1184096246 9 Left 1184096232 22:42317930-42317952 CCTGGCAGCCCCATTGGCCACAC No data
Right 1184096246 22:42317962-42317984 CCTATGGGGCAGGCAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184096232 Original CRISPR GTGTGGCCAATGGGGCTGCC AGG (reversed) Intronic