ID: 1184096712

View in Genome Browser
Species Human (GRCh38)
Location 22:42320016-42320038
Sequence TGGTGGGAATGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1609
Summary {0: 1, 1: 0, 2: 6, 3: 153, 4: 1449}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184096712_1184096719 -5 Left 1184096712 22:42320016-42320038 CCATCTTCCCTCCATTCCCACCA 0: 1
1: 0
2: 6
3: 153
4: 1449
Right 1184096719 22:42320034-42320056 CACCACTGCCATCTCGGTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184096712 Original CRISPR TGGTGGGAATGGAGGGAAGA TGG (reversed) Intronic
900088284 1:908809-908831 AGGGGGGAAGGGAGGGATGAGGG + Intergenic
900204828 1:1427391-1427413 TGGAGGGAAGGGGGAGAAGAGGG - Intronic
900487457 1:2930102-2930124 TGGTGGAAAAGGAGAGAAGCCGG + Intergenic
900681722 1:3920268-3920290 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
901169072 1:7242327-7242349 TAGTGGGAATGAATGGAAAATGG + Intronic
901657600 1:10779187-10779209 AGGTGGGGAGGCAGGGAAGACGG - Intronic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901774664 1:11552070-11552092 TGTAGTGAATGAAGGGAAGATGG + Intergenic
901787105 1:11632016-11632038 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
901814976 1:11788769-11788791 TGAGTGGAATGCAGGGAAGAGGG - Exonic
902136659 1:14312082-14312104 TGGTGGGAATAGAAATAAGAGGG + Intergenic
902203954 1:14853706-14853728 TGGTGGGACTGGCTGGGAGAGGG - Intronic
902364078 1:15959482-15959504 AGGAGGGAAGGGAAGGAAGAGGG + Intronic
902700261 1:18167572-18167594 CGGTGGGAAAGGAGGGAACTTGG - Intronic
902828345 1:18992966-18992988 GGGTGGGCATGAATGGAAGAGGG - Intergenic
903106440 1:21084592-21084614 TGGCTGGAATGGAGGGAGGTTGG - Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903768755 1:25750978-25751000 TGGACGGAAGGGAGGAAAGATGG - Intronic
903834598 1:26195179-26195201 TGGTGGGAGAAGAGGGATGAGGG - Intronic
904590561 1:31613020-31613042 TGGTGGGAAAGGTGGGGAGCTGG - Intergenic
904727187 1:32558136-32558158 TGGGGGAAAAGGAGGGAAGTAGG + Intronic
904881899 1:33706355-33706377 TGGAGGCAATGAACGGAAGATGG - Intronic
904947833 1:34212449-34212471 TGGTGGGAACGGGGGCAAGTTGG + Intronic
905197919 1:36295604-36295626 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
905241781 1:36586282-36586304 TCGTGGGAGGGGAGGGGAGAAGG + Intergenic
905467597 1:38167048-38167070 AGGTGGGAATGGAGTGAGGAGGG + Intergenic
905751422 1:40467968-40467990 TGCTGGGGTTGGACGGAAGATGG - Intergenic
905936463 1:41827923-41827945 GGCAGGGAAGGGAGGGAAGAGGG + Intronic
906143648 1:43547712-43547734 TGAGGGGAGTGGAGGGAAGCGGG + Intronic
906236091 1:44211759-44211781 AGGAAGGAATGAAGGGAAGAAGG - Intergenic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906257140 1:44359083-44359105 TGGTGGTCATGGTGGGAAGAGGG - Intergenic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906520563 1:46464613-46464635 TGGTGGCAAGGGAGGGAGAAGGG - Intergenic
906566327 1:46803758-46803780 TGGTGGGCCTGCAGGGAGGAGGG + Intronic
906686379 1:47765946-47765968 TGGTGGCGATGGCGGGGAGAAGG + Exonic
907038200 1:51235423-51235445 GGTTGGGAGTGGAGGGAAGTGGG + Intergenic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907174144 1:52502240-52502262 TGGAGGGAATGGTTGGAGGAAGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907499134 1:54865790-54865812 AGGTGGGAAGGGAGGGAGGGAGG - Intronic
907553801 1:55327251-55327273 AGGTGGAGAAGGAGGGAAGAAGG + Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907901565 1:58746303-58746325 TGGTGGACATGGAGAGAAGGGGG - Intergenic
907923507 1:58934599-58934621 TGGGGGGAATGGAAGGAAGGTGG + Intergenic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908186537 1:61657784-61657806 TGGTGGGACTAGAGGGAAAGTGG + Intergenic
908250104 1:62258978-62259000 TGGCTGGAGTGGAGGGAAGGAGG + Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908843429 1:68300795-68300817 AGGAAGGAATGGAGGAAAGAAGG - Intergenic
909005060 1:70265923-70265945 AGGGAGGAAGGGAGGGAAGAAGG + Intronic
909094831 1:71273635-71273657 TGGAGGGAATGGTGAGAAAAAGG + Intergenic
909517961 1:76533584-76533606 TGGAGGGAATGGAAGAAATATGG - Intronic
909624438 1:77700037-77700059 TGGTGGGGGTTGAGGGATGAGGG + Intronic
909692101 1:78420842-78420864 AGGAGGGAAGGGAGGGAGGAAGG - Intronic
909837134 1:80270433-80270455 TAATGGGAAAGGAGGCAAGAGGG - Intergenic
910274271 1:85431546-85431568 AGGTGAGGAAGGAGGGAAGAAGG - Intronic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
910474828 1:87595635-87595657 AGGAGGGAAGGGAGGGAAGAGGG - Intergenic
910632130 1:89366434-89366456 TGATGGGAATAGAAGGGAGAAGG - Intronic
910848832 1:91631158-91631180 TGGGGGGATTGGGGAGAAGAAGG + Intergenic
911053956 1:93695139-93695161 GGGTGGGCAGGGAAGGAAGAAGG - Intronic
911165672 1:94722353-94722375 TGGTGGGAAAGGAGGGGACAGGG + Intergenic
911233978 1:95390095-95390117 TGGTGAGAATGTGGGGAAAAGGG - Intergenic
911723802 1:101220238-101220260 TGGGGAGAATTGAGGGAAGCAGG + Intergenic
911995299 1:104758241-104758263 GGGGGGGAATGGGGGGAGGAGGG + Intergenic
912437723 1:109673571-109673593 TGGTGGGAAGGGAGGGATGGAGG + Intronic
912440226 1:109691970-109691992 TGGTGGGAAGGGAGGGGTGGAGG + Intronic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912583082 1:110737578-110737600 TGGTGGGAATATTGGGAAGCTGG + Intergenic
912592583 1:110840341-110840363 TGGTGAGAATGTAGAGAAGTTGG + Intergenic
912688160 1:111783329-111783351 TGGTGGAAATTCAGGGAAGGAGG - Intronic
912791028 1:112651156-112651178 TGGTGGAAATCCAGGAAAGATGG - Intronic
913374844 1:118139795-118139817 TGGGGGGAATGGAAAGATGATGG + Intronic
913528681 1:119716870-119716892 TGGTGAGCATGGAGGGAAACAGG - Intronic
913662710 1:121018937-121018959 TGATGAGCATAGAGGGAAGAAGG - Intergenic
914024888 1:143903918-143903940 TGGGAGGGATGGAGGGAAGGAGG - Intergenic
914216257 1:145632387-145632409 TGGGAGGAATGGAGAGATGATGG - Intronic
914454393 1:147822325-147822347 TGGTAGGAAGGTAGGGCAGAGGG - Intergenic
914468828 1:147955046-147955068 TGGGAGGAATGGAGAGATGATGG - Intronic
914652711 1:149710757-149710779 TGATGAGCATAGAGGGAAGAAGG - Intergenic
914663317 1:149811638-149811660 TGGGAGGGATGGAGGGAAGGAGG - Intronic
914684677 1:149967859-149967881 TGGTGGGAGGAGAGGGAATAAGG + Intronic
914986715 1:152464319-152464341 TGGTGGGGGGGGAGGGGAGAGGG - Intergenic
915001018 1:152591549-152591571 TGGTGAGAATGCAGAGAAAAGGG - Intronic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915213199 1:154324984-154325006 TGGTGGGGGCGGAGGGAAGGAGG + Exonic
915276819 1:154794755-154794777 AGGTGGCACTGGAGGGAGGAAGG + Intronic
915341368 1:155178649-155178671 TGCTGGGGAGGAAGGGAAGAAGG - Intronic
915736993 1:158091332-158091354 TGGTGGAGAGGGAAGGAAGAAGG - Intronic
915914167 1:159931268-159931290 AGGGGGGAATGGAGGGATGGTGG + Intronic
915948764 1:160173746-160173768 GGCTGGGGATGGAGGGAACATGG - Intronic
916481621 1:165219435-165219457 TGTTGTGAGTGGAGGGAGGAGGG + Intronic
916991059 1:170245930-170245952 TGGTGGGAATGTATGAAAAACGG + Intergenic
917506740 1:175634300-175634322 TGGATGAAATGGAGGGAAGGCGG - Intronic
917562032 1:176168479-176168501 AGGCAGGAAGGGAGGGAAGAAGG + Intronic
917999898 1:180483346-180483368 TGGAGAGAAAGCAGGGAAGAAGG - Intronic
918018273 1:180659446-180659468 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
918031307 1:180814894-180814916 GGGTGGGGATGGAGTGTAGAAGG + Intronic
918094270 1:181321729-181321751 TGGGGGGAAAGGAGGCAGGACGG + Intergenic
918216312 1:182394465-182394487 GGGTGGCAATTTAGGGAAGAAGG - Intergenic
918216530 1:182396657-182396679 AGGTGGGAGGGGAGGGAGGAAGG - Intergenic
918248200 1:182679264-182679286 TGGTGGGAATGGAAGCCAAATGG - Intronic
918640614 1:186837219-186837241 TGGTGGGAGTAGACAGAAGAAGG + Intronic
918660476 1:187081827-187081849 TGGAGGGAAGGAAGGAAAGAAGG - Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
918857754 1:189780666-189780688 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
919064950 1:192682894-192682916 TGTTCGGAATAGAGGGAAGGGGG - Intergenic
919086928 1:192931617-192931639 GGTTGGGAAGGGAGGGAAGTGGG - Intergenic
919347987 1:196411010-196411032 AGGTGGGAAGGGAGGGAGGGAGG - Intronic
919548359 1:198951673-198951695 TTTGGGGAATGGAGGGTAGAGGG - Intergenic
919881454 1:201903772-201903794 TTTTGGGAAAGGAAGGAAGAGGG - Intronic
919887627 1:201946383-201946405 TGGTGGGCAGGGAAGGGAGAGGG + Exonic
919887857 1:201947838-201947860 TGGGGGGACTGAAGGGCAGAAGG + Intergenic
920039548 1:203086388-203086410 TGGTGGGTATAGGGGGAGGAGGG + Intergenic
920110486 1:203583809-203583831 AGGTGGGAACGGAGGGAGGGAGG + Intergenic
920116283 1:203624131-203624153 AGGAGGGAAGGGAGGGAGGAAGG + Intergenic
920209815 1:204320106-204320128 TGGTGGGAAAGGAGAGAATAAGG - Intronic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921525036 1:216207002-216207024 TGATGGGAATGTGGGGAAGCTGG - Intronic
922197871 1:223375561-223375583 TGGTGATAATGCAGGGAAAAGGG + Intergenic
922201788 1:223409229-223409251 GGGTGGAAATGGAGGAAAGTGGG + Intergenic
922483488 1:225955770-225955792 TGTGGGGAATGGAGGAAAGGAGG + Intergenic
922560348 1:226565080-226565102 TGGTAGGCATGGAGGAAAGGAGG + Intronic
922976733 1:229791146-229791168 TGGTGCCTATGGTGGGAAGAAGG - Intergenic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
923234396 1:232018739-232018761 TGGAGGGACAGCAGGGAAGATGG + Intronic
923284499 1:232479638-232479660 TGTTGGGCATGTAGGGAAGCAGG + Exonic
923310524 1:232730355-232730377 TGGTAGAAATGGAGAGAAGTAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923452866 1:234136175-234136197 AGGAGGGAAGGGAGGGAAGAAGG - Intronic
923501933 1:234572308-234572330 TGGTGGGAAGGCAGGGAGAAGGG - Intergenic
923964515 1:239122390-239122412 TGGTAGGAATGAAGAGAAGCTGG + Intergenic
923996811 1:239504907-239504929 TGGGGGGAAGGGTGGGAAGGGGG + Intronic
924298618 1:242614140-242614162 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
924328674 1:242921177-242921199 GGGAGGGAATGGAGGGGAGGAGG + Intergenic
924421025 1:243910237-243910259 TGGTGGGAAGGAAAGGAACAGGG + Intergenic
1063122559 10:3115029-3115051 TGGAGGGCACGGAGGGCAGATGG + Intronic
1063180689 10:3596352-3596374 AGGAGGGAAGGGAGAGAAGAGGG + Intergenic
1063459337 10:6205283-6205305 TTACTGGAATGGAGGGAAGAAGG + Intronic
1063556430 10:7084062-7084084 TGGTGGGAACAGAAGGAGGAGGG + Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063805886 10:9639862-9639884 TGGTGGGAAGGGTGGCAGGATGG + Intergenic
1064134836 10:12741728-12741750 TGCCGGGAAGGGAGGGAAGCAGG + Intronic
1064154673 10:12894207-12894229 GGGAGGGAAAGGAGGGAAGGAGG - Intergenic
1064449183 10:15426189-15426211 TGGTGGGGGCGGGGGGAAGAGGG + Intergenic
1064479676 10:15726695-15726717 TGATGGGGCTGGAGGTAAGACGG + Intergenic
1065091200 10:22235411-22235433 TGGTGTGAATGGGGGTGAGAAGG - Intergenic
1065161490 10:22927526-22927548 TGGGGGGCATGGGAGGAAGAAGG + Intergenic
1065497259 10:26341983-26342005 GGGGAGGAGTGGAGGGAAGAAGG + Intergenic
1065738927 10:28779201-28779223 TGGTTGGACATGAGGGAAGATGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066415493 10:35217523-35217545 TGGTTTGAATGGACGGAAGCTGG + Intergenic
1067143778 10:43678801-43678823 TGGTGGGCAGACAGGGAAGATGG - Intergenic
1067170239 10:43900025-43900047 TGGTGGGATTGGAGGCTTGAAGG + Intergenic
1067781655 10:49211968-49211990 TGGAGGGAGTGGAGGAAAGGAGG + Intergenic
1068077481 10:52274814-52274836 TGGTGTGGATGGAGTGAACAGGG - Intronic
1068133966 10:52932069-52932091 AGGTGGGAATGGAGAAAAAAGGG + Intergenic
1068643886 10:59443985-59444007 TAGTGGGAATGTGGGGAAAAGGG + Intergenic
1068851243 10:61743851-61743873 TGGTGGGAGGGAAGAGAAGAAGG - Intronic
1068945959 10:62729133-62729155 TGCTGGGCTTGCAGGGAAGATGG - Intergenic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069938317 10:71935056-71935078 TGGTGGGGAAGGATGGAAGTGGG - Intergenic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1070659189 10:78292821-78292843 TGGTGGGAGTGAAGAGCAGAAGG - Intergenic
1070722964 10:78769447-78769469 TGGTGGGGCTGAAGGAAAGAAGG - Intergenic
1071014974 10:80986416-80986438 TGGTGGGAATGGGGTGAGGAGGG - Intergenic
1071054203 10:81490480-81490502 TGGGGGAAAGGGTGGGAAGAGGG - Intergenic
1071284227 10:84129525-84129547 GGGTCAGAATGGAGGGGAGAAGG - Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1071862264 10:89686314-89686336 TGGTGGGAATGGACAAGAGAGGG + Intergenic
1072037988 10:91581922-91581944 TGGTGGTATTGGAGGGGAAAGGG - Intergenic
1072252420 10:93591959-93591981 TTATGGGAACTGAGGGAAGATGG + Exonic
1072771639 10:98144903-98144925 TGGAGGGAATGGTGTGAAGTTGG + Intronic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073091110 10:100940720-100940742 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
1073171315 10:101511181-101511203 TGGTGGGAATTAAGGAAAAATGG - Intronic
1073348472 10:102802009-102802031 TGGGGGGAAGGGTGGGAAGGTGG - Intronic
1073585395 10:104704999-104705021 GGTTGGGAAATGAGGGAAGAGGG - Intronic
1073645319 10:105295717-105295739 TGTTGGGGGTGGAGGGAAGGGGG - Intergenic
1074102282 10:110363290-110363312 GGGTGGGATTGGATGAAAGAGGG - Intergenic
1074293392 10:112158867-112158889 TGGTGGGATGGAAGGGATGAGGG - Intronic
1074430128 10:113387274-113387296 TGGTGGGGATGGGGTGAGGAGGG - Intergenic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1074869330 10:117564693-117564715 TGGAGAGAAAGGAGGGAGGAGGG + Intergenic
1075135215 10:119778596-119778618 TGAGGAGAATGGAGGGAAAATGG - Intronic
1075148053 10:119900026-119900048 TGAGGGGAAGGGAGGGAAGAGGG - Intronic
1075245354 10:120817679-120817701 AGGTGAGGAGGGAGGGAAGAGGG - Intergenic
1075312310 10:121424701-121424723 TGGTGTGGAAGGAGGGTAGAGGG + Intergenic
1075412768 10:122241203-122241225 TGGTGTGGAAGGAGGTAAGATGG + Intronic
1075624332 10:123950882-123950904 TGGGGGGAAGGAAGGGAAGAAGG + Intergenic
1075685867 10:124364754-124364776 TGGTGGGAAAGAAGGGAGCAGGG + Intergenic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1076138742 10:128063263-128063285 TGGGAGGAAGGGAGGGAAGTAGG - Intronic
1076297087 10:129394594-129394616 AGGTGGCAATTGTGGGAAGAGGG - Intergenic
1076619129 10:131775793-131775815 AGGTGGGAGTGGAGAGGAGAAGG + Intergenic
1076708083 10:132313087-132313109 TGGTGGGATGGGAGGTCAGACGG + Intronic
1076725182 10:132409766-132409788 TGCTGAGAAGGAAGGGAAGAGGG + Intronic
1077138692 11:1014034-1014056 GGGTGGGCATGGAGCGAGGAGGG + Intronic
1077253305 11:1570206-1570228 TGGTGGGAAGGGAGGGAACCTGG - Intronic
1077278932 11:1733267-1733289 TGGTGGGATGGGAGGGCAGGAGG - Exonic
1077283168 11:1754521-1754543 TGGAGGGGATGGAGGGATGGAGG + Intronic
1077283178 11:1754546-1754568 TGGAGGGGATGGAGGGATGGAGG + Intronic
1077283211 11:1754675-1754697 TGGAGGAAATGGAGGGATGGAGG + Intronic
1077604195 11:3596478-3596500 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1078670134 11:13357253-13357275 TGGAGAGCATGGAGGGCAGAAGG - Intronic
1078831824 11:14984794-14984816 TGGTGAAACTGGAGGGAAGTAGG - Intronic
1078889609 11:15542645-15542667 TGACTGGAATGCAGGGAAGAGGG - Intergenic
1078923647 11:15854461-15854483 AGGAGGGAAGGAAGGGAAGAAGG + Intergenic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1079042085 11:17068261-17068283 TGGGTGCAATGGAGGTAAGATGG + Intergenic
1079133446 11:17762811-17762833 GGGTGGGAATGGAGAGACGAAGG - Intronic
1079134606 11:17769313-17769335 TGGTTGGAAGGGAGGGATGGAGG + Intronic
1079828411 11:25229787-25229809 TGGGGTGGAGGGAGGGAAGAGGG - Intergenic
1079910766 11:26306755-26306777 AGTTAGGAATGCAGGGAAGAAGG - Intergenic
1079925007 11:26483202-26483224 TGGTGAGAATGCAGAGAAAAGGG - Intronic
1079956051 11:26866067-26866089 AGGAAGGAAGGGAGGGAAGACGG + Intergenic
1080048905 11:27838439-27838461 GGGAGGGAAGGGAGGGAGGATGG - Intergenic
1080198756 11:29643774-29643796 TGGTGTGGATGTAGGGAAAAGGG + Intergenic
1080539002 11:33248762-33248784 TGGAAGGACTGAAGGGAAGAAGG + Intergenic
1080840135 11:35976358-35976380 TGGTGGGAAAGGAGGGTAGGAGG + Intronic
1080902551 11:36509920-36509942 TGGTGGGAAGCGAGGGGACAGGG + Intronic
1081340541 11:41922064-41922086 TGGTGGAAATGAAGCAAAGAAGG - Intergenic
1081390496 11:42523393-42523415 TGAGAGGAATGGTGGGAAGAGGG - Intergenic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081749547 11:45500118-45500140 TGTTGGGGATGTAGAGAAGATGG + Intergenic
1082315991 11:50723233-50723255 TGGTGGGGGTGGAGGGGGGAGGG - Intergenic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082901150 11:58254094-58254116 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1082906051 11:58309743-58309765 TGATGGGAGTGGAGCCAAGATGG - Intergenic
1082914743 11:58420508-58420530 TGGTGGGAGTGGGGGAAATAGGG + Intergenic
1083125133 11:60557629-60557651 TGGTGGGAATGCAGAGAAAGGGG + Intergenic
1083155433 11:60820106-60820128 TGTGGGGAATGGAGGTAAAAGGG - Intergenic
1083224658 11:61277066-61277088 TGGAGGGAAGGGAGAGAGGAAGG + Intronic
1083253546 11:61482963-61482985 TGGTGGGGATGGTGGGGACAAGG - Intronic
1083254479 11:61487713-61487735 TGGTGGGCATGGAAAGAACAGGG + Intronic
1083427393 11:62595544-62595566 TGCAGGGAATGGAAGAAAGAAGG - Intronic
1083429900 11:62608923-62608945 TGGTGGGCTTGGCAGGAAGAGGG - Intronic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083584557 11:63847322-63847344 TGGTAGGAGAGGAGGGGAGATGG + Intronic
1083602495 11:63957739-63957761 TTCTGTGAATGGATGGAAGAGGG - Intergenic
1083840512 11:65301704-65301726 TGGGGGCAGGGGAGGGAAGAGGG + Intronic
1083853006 11:65378807-65378829 AGGGGTGGATGGAGGGAAGAGGG - Intronic
1083891081 11:65595987-65596009 TGGTGGGGATGGGTGGAGGAAGG + Exonic
1084030346 11:66477255-66477277 TGGTGGGCATTCAGGGATGATGG - Exonic
1084198042 11:67537073-67537095 AGGTGGGAATGGAGGTAGGCAGG - Intergenic
1084226645 11:67719290-67719312 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1084260093 11:67971072-67971094 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1084399738 11:68936719-68936741 TCGTGGGAATTGAGGGAAGGAGG - Exonic
1084486697 11:69452329-69452351 AGGTGGGAAAGGAAAGAAGAAGG + Intergenic
1084812679 11:71624182-71624204 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1084955887 11:72691377-72691399 TGGGCAGAAGGGAGGGAAGATGG - Intronic
1085013600 11:73158069-73158091 TGGGGGGGGTGGTGGGAAGATGG + Intergenic
1085415829 11:76318531-76318553 TGGTGGGAACCGAGAGGAGAGGG + Intergenic
1085806723 11:79643263-79643285 AGGAAGGAAGGGAGGGAAGAGGG + Intergenic
1085907790 11:80785503-80785525 TGTTGGGGAGGGAGGGAACAAGG - Intergenic
1086474548 11:87157798-87157820 TGGAGAGAAGGGAAGGAAGAGGG + Intronic
1087219282 11:95528562-95528584 TGGTGGGGATGCAGTGAAAAGGG - Intergenic
1087237366 11:95734860-95734882 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
1087679719 11:101206149-101206171 TGGTGAGAATGCAGAGAAAAGGG - Intergenic
1087692972 11:101343270-101343292 TGGTGAGAATGTGGGGAAAAGGG - Intergenic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1087906100 11:103699707-103699729 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
1087931869 11:103987275-103987297 GGGTGGGAAAGGAAGGAGGATGG - Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1089621755 11:119726716-119726738 TGGTGGGAAGGGTTGGGAGAAGG - Intronic
1089719594 11:120402570-120402592 TGGTTGAAATGAAGGGGAGATGG - Intronic
1089760697 11:120720866-120720888 GGGTGAGGATGGAGGGAAAAGGG + Intronic
1090171963 11:124613192-124613214 TGGTGGGGATAGAGGCAAGAGGG - Intronic
1090239087 11:125169438-125169460 TGGTGGGAAAGGGAGGAAGGAGG + Intronic
1090430602 11:126642974-126642996 TGGATGGATGGGAGGGAAGAAGG - Intronic
1090432197 11:126655437-126655459 TGGGGGGAGTGGAGGGGTGAAGG - Intronic
1090623585 11:128585298-128585320 GGGAGGGAAGGGAGGGAAGAAGG + Intronic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1090947845 11:131447753-131447775 TTGGGGGAAGGGAGAGAAGAGGG + Intronic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091121604 11:133062593-133062615 TGTAGGGAAAGGAGGGATGAAGG - Intronic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1091568422 12:1663789-1663811 AGGAGGGAAAGGAGGGAAGGAGG + Intergenic
1091668999 12:2439025-2439047 TGGGGGCAATGGAGTGGAGAGGG - Intronic
1091798550 12:3310687-3310709 TGGTGGTAATAGAAGGAAGGTGG - Intergenic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1091969487 12:4773573-4773595 TGGTGGGAGAGGAGGTAGGATGG + Intronic
1092041253 12:5386672-5386694 TGGAGAGAAAAGAGGGAAGATGG - Intergenic
1092049806 12:5460345-5460367 TGGTGGCAGAGGAGGGAGGAGGG - Intronic
1092051951 12:5477725-5477747 AGAAGGAAATGGAGGGAAGAGGG - Intronic
1092358890 12:7819554-7819576 TGGTGGAAAGGGCAGGAAGAAGG - Exonic
1092372010 12:7924482-7924504 TGGTGGAAAGGGCAGGAAGAAGG - Exonic
1092657670 12:10704124-10704146 TGGTGAGATTGGAGAGATGAAGG - Exonic
1092937915 12:13380848-13380870 AGGTGGAGATGGAGGGAGGATGG - Intronic
1092954162 12:13534085-13534107 TGGTGGCAGTGGAGGAAAAAAGG - Intergenic
1092975974 12:13745296-13745318 TGGTGGGAAGAGAGAGCAGATGG + Intronic
1093093246 12:14944330-14944352 GGGTGGCATTGGAGGGAAGGGGG - Intronic
1093390602 12:18615114-18615136 TGGGGGGAAGGGTGGGAAGTGGG - Intronic
1093967712 12:25345023-25345045 TGGGGGGGAAGTAGGGAAGAAGG + Intergenic
1094220118 12:27983918-27983940 TGGGGGGAAAGGATGGAAGATGG + Intergenic
1094628699 12:32151065-32151087 TGGTGGGGTTGTTGGGAAGATGG + Intronic
1094725760 12:33114085-33114107 TCGAGGGAGTGGTGGGAAGAGGG + Intergenic
1095572633 12:43700395-43700417 TGCTGGGAATCCAGGAAAGAAGG + Intergenic
1095818867 12:46455101-46455123 TGGAGGCAGTGGAGGGAAGATGG - Intergenic
1095829087 12:46564002-46564024 TGGTGAGAATGTAGAGAAAAGGG - Intergenic
1095943113 12:47739104-47739126 AGGGGGGAATGGAGGGATGGAGG + Intronic
1095982843 12:47982699-47982721 TGGGAGGAAGGGAAGGAAGAGGG - Intronic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1096334678 12:50744475-50744497 TGGTTGGGATTGAGGGGAGAAGG + Intronic
1096415919 12:51413050-51413072 TGGTGAGGATGCAGGGAAAAGGG - Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096661787 12:53129902-53129924 TGGTAGGAGGAGAGGGAAGAGGG - Intergenic
1096760295 12:53836137-53836159 AGTGGGGAATGGAGGGAAGCCGG + Intergenic
1096760404 12:53836880-53836902 TGGTGGGATTGGGGTGGAGAGGG + Intergenic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1096790327 12:54040377-54040399 TGGTGGGAAGGGAGGGAGGGAGG - Intronic
1096996649 12:55842442-55842464 TGATGGGAGTGGAGGTAAGCAGG + Intronic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097268003 12:57756678-57756700 TGGGGGGATTAGAGGGGAGAAGG - Intronic
1097324948 12:58265994-58266016 TGGTGAGGAGGTAGGGAAGAGGG + Intergenic
1097518099 12:60632194-60632216 TGGTGAGAATGTGGGGAAAAGGG + Intergenic
1097602180 12:61706792-61706814 AGGAAGGAAGGGAGGGAAGAAGG + Intergenic
1097622561 12:61958454-61958476 TGGTAGGAATACAGGGAAAAAGG - Intronic
1097623808 12:61975301-61975323 TGGGTGGAAGTGAGGGAAGAAGG - Intronic
1097899425 12:64858185-64858207 TGGTGGGAATGGAGGGTGGGCGG - Intronic
1098177280 12:67805954-67805976 TGGTGGGGAAGGAGGGAGGGAGG - Intergenic
1098406613 12:70133137-70133159 TGGTGAGAATGCAGAGAAAAGGG - Intergenic
1098469398 12:70826309-70826331 TAGTGGGAAAGGTGAGAAGAGGG + Intronic
1098666930 12:73176038-73176060 TGGAGGAAATGGAGGTAAGGGGG + Intergenic
1098725268 12:73956908-73956930 TGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098953767 12:76667987-76668009 TGGTGGGAGGGGAAGGAAGAGGG - Intergenic
1099005770 12:77233210-77233232 GGGAGGGAATGAAGGAAAGAAGG - Intergenic
1099351217 12:81571293-81571315 TCTTGGGAGTGGAAGGAAGAAGG + Intronic
1099533160 12:83812463-83812485 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1099941491 12:89194525-89194547 TGTTGGGGAAGGAGGGAGGAAGG - Intergenic
1099955167 12:89346166-89346188 TGGTGAGAATAGAGGGAAACAGG + Intergenic
1100065684 12:90641393-90641415 GGGAAGGAAGGGAGGGAAGAAGG + Intergenic
1100580619 12:95936150-95936172 GGGTGGGAAAGGAAAGAAGAGGG + Intronic
1100748059 12:97667300-97667322 AGGAAGGAAGGGAGGGAAGAGGG + Intergenic
1100948424 12:99816117-99816139 TGGTGGGAATGTGGTGAAAAGGG - Intronic
1101852349 12:108414020-108414042 TGGGGGCAAAGCAGGGAAGAGGG + Intergenic
1101925181 12:108965954-108965976 GGGAGGGAATGGAGGGAGGGAGG - Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102531958 12:113553277-113553299 TGGAGAGAATGGAGGGAACCAGG + Intergenic
1102575549 12:113853975-113853997 TGGTGGGCATGGTAGGGAGAAGG + Intronic
1102676531 12:114663276-114663298 TGGTGGCAGTGGAGAGGAGAGGG + Intergenic
1102901997 12:116646167-116646189 TGGTGGGGGAGGAGAGAAGAAGG + Intergenic
1102992109 12:117322725-117322747 GGGAGGGAAGGGAGGAAAGAGGG - Intronic
1103052357 12:117791158-117791180 TGGTGGGCATAAAGGAAAGAAGG - Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103234033 12:119357375-119357397 TGTTGGGAATGGAGAGAGGTTGG - Intronic
1103584788 12:121944287-121944309 TGGGGGGAAAGGAAAGAAGATGG - Intronic
1103737975 12:123072551-123072573 TGGTGGGAATGAATGAATGAGGG - Intronic
1103879806 12:124157389-124157411 AGGTGGGAGTGGAGGGAACGAGG + Intronic
1104278717 12:127354140-127354162 TGGTGGAGGTGGAGGGAAGTGGG + Intergenic
1104325073 12:127788115-127788137 TGGTGAGAATGCAGAGAAAAGGG - Intergenic
1104329714 12:127833537-127833559 TGGTGGACATGGAGAGATGATGG + Intergenic
1104646757 12:130502916-130502938 TGGTAGGGATGGAGGGGACAGGG + Intronic
1104668902 12:130667145-130667167 AGGGAGGAAGGGAGGGAAGAAGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105638825 13:22241624-22241646 TGGATGGAATGGATGGATGATGG - Intergenic
1105638829 13:22241644-22241666 TGGATGGAATGGATGGATGATGG - Intergenic
1105948350 13:25208661-25208683 TGGAAGGAAGGGAAGGAAGAAGG + Intergenic
1106031035 13:26003160-26003182 TGGTGAGAATGCAGAGAAAAAGG - Intronic
1106353473 13:28956765-28956787 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353487 13:28956825-28956847 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106359693 13:29019216-29019238 TGCAGGGACTGGTGGGAAGAGGG + Intronic
1106501879 13:30336684-30336706 TGGAGGCACTGGAGGGGAGAAGG - Intergenic
1106737425 13:32602233-32602255 TGAGGGGAAGGGAGGGGAGAGGG - Intronic
1107007510 13:35630936-35630958 AGGGGGGAATGGTGGGAAGTGGG - Intronic
1107139710 13:36984741-36984763 CGGTGGGAAGGCAGGGAGGAGGG + Intronic
1107285534 13:38786209-38786231 AGCTGGGAAGGGAGGAAAGATGG - Intronic
1107546322 13:41436805-41436827 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1107756595 13:43630087-43630109 TGGTGAGAATGGTGGGATTAGGG - Intronic
1107788488 13:43977802-43977824 GGGAGGGAAGGGAGGGGAGAGGG - Intergenic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1108268537 13:48735891-48735913 GGGAGAGAATGGAAGGAAGAAGG + Intergenic
1108357738 13:49642561-49642583 TGGAAGGAAGGGAGGAAAGAAGG + Intergenic
1108394905 13:49982518-49982540 TGTGGGGTATGCAGGGAAGAAGG + Intergenic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1109405820 13:61898812-61898834 GGGAGGGAAGGAAGGGAAGAAGG - Intergenic
1109671325 13:65612233-65612255 GGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1109828010 13:67748360-67748382 TGGTGAGAATGCAGAGAAAATGG - Intergenic
1109924920 13:69124155-69124177 TTGGGGGAATGGTGGGAGGAGGG + Intergenic
1109971743 13:69779396-69779418 GGGAAGGAAAGGAGGGAAGAGGG - Intronic
1110470009 13:75848891-75848913 TGGTGTGAATGCAGGGAAAAGGG - Intronic
1110474000 13:75891941-75891963 TGGTGGGTTTGGAGAGAGGAGGG - Intergenic
1110497750 13:76189615-76189637 AGGTAAGAATGGAGGGAAAAGGG - Intergenic
1110641517 13:77830182-77830204 GGGAGGGAGGGGAGGGAAGAAGG - Intergenic
1110641526 13:77830203-77830225 AGGGGGGGAGGGAGGGAAGAAGG - Intergenic
1110641536 13:77830223-77830245 GGGAGGGAGGGGAGGGAAGAAGG - Intergenic
1110879381 13:80552602-80552624 TGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1111106128 13:83647914-83647936 TGATGGGAATTGAAGAAAGATGG - Intergenic
1111118279 13:83811162-83811184 TGGTAGGTATGAAGGGCAGATGG - Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111162442 13:84413622-84413644 GGGTGAGAATGGGGAGAAGAGGG - Intergenic
1111577120 13:90169805-90169827 TGGTGAGAATGTAGAGAAAAGGG + Intergenic
1111791749 13:92865502-92865524 TGTGGGGAAGGGAGGGGAGATGG + Intronic
1111900768 13:94197111-94197133 TGCTAGGACTGTAGGGAAGATGG + Intronic
1112138814 13:96614495-96614517 TGGTGGGGATGGTGGGTTGAAGG + Intronic
1112232794 13:97606498-97606520 TCCTGGAAAGGGAGGGAAGAAGG - Intergenic
1113077820 13:106485326-106485348 AGGTGAGAAAGGAAGGAAGAAGG - Intergenic
1113090133 13:106609273-106609295 TGTAGAGAATGGATGGAAGAGGG + Intergenic
1113278977 13:108767654-108767676 TGGTAAGAGTGAAGGGAAGAAGG + Intronic
1113507313 13:110826184-110826206 TGGTGGGAGTGAAGGGCAGGCGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113663072 13:112120218-112120240 TGGGAGGAATGGAGGGAGGGAGG + Intergenic
1113808894 13:113125740-113125762 TTGAGGGAATGAAGGAAAGATGG - Intronic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114519818 14:23326034-23326056 TGGAGGGAATGGGAGGAAGTGGG + Exonic
1114647591 14:24264187-24264209 TAGTGGGAAGGAAGGAAAGAAGG - Intronic
1114841961 14:26274082-26274104 TGGGGGGAAGGGTAGGAAGAGGG + Intergenic
1114973312 14:28061792-28061814 TGAAGGGAGTGGAGGTAAGAAGG - Intergenic
1115282236 14:31677318-31677340 TGGTGGGGGTGGAGGGAATGGGG - Intronic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1115971824 14:38953229-38953251 TGGTGGGAATGGGGAGAGGGTGG - Intergenic
1115975769 14:38995429-38995451 GGGTGGGCATAAAGGGAAGAGGG - Intergenic
1116026332 14:39519923-39519945 TGGTGGGACTGCAGAGAAAAAGG + Intergenic
1116223835 14:42122035-42122057 TGGGGGGAAGGGTGGGAGGAAGG + Intergenic
1116895100 14:50308613-50308635 TGGTGAGAATGAAGGGAAACTGG + Intronic
1117212863 14:53519475-53519497 TGGTGGAAGGGGAGGGAAGCTGG + Intergenic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1117528285 14:56633363-56633385 TGGGGAGAGAGGAGGGAAGAGGG + Intronic
1117658696 14:57982605-57982627 TGTTGGGAATGGAAAGAACATGG + Intergenic
1117754127 14:58956507-58956529 TGGTGGGAAGGGAAAGAACAGGG + Intergenic
1117771939 14:59142311-59142333 TGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1117917612 14:60694281-60694303 TGGTGAGAATGCAGAGAAAAGGG - Intergenic
1118153322 14:63213277-63213299 AGTTGGGAAGGGAAGGAAGAGGG - Intronic
1118296967 14:64579112-64579134 AGGTGGGAATGGTAGGAGGAGGG + Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118580872 14:67296107-67296129 TGAGGGGAATGGTGAGAAGAAGG + Intronic
1118763309 14:68893851-68893873 TGGTTGGAAGGGAGTTAAGAAGG + Intronic
1118837305 14:69485936-69485958 TGGGAGGTATTGAGGGAAGAGGG + Intronic
1118881929 14:69836216-69836238 TGGTGTGAAAGGAGGGGACAGGG - Intergenic
1118906705 14:70028697-70028719 TGGAGGGAGTGGAGGAAAGGTGG + Intronic
1119130456 14:72167971-72167993 TGGTGGGGATTCTGGGAAGAGGG + Intronic
1119182774 14:72615592-72615614 TGGGTGGAAGGGAGGGAAGGAGG - Intergenic
1119294362 14:73521048-73521070 GGGTGAGAAAGGAGGGAAAAGGG + Intronic
1119402218 14:74370661-74370683 TGGTGGAAGTGGAGAGAAGTAGG - Intergenic
1119757333 14:77128381-77128403 GGGTGGGAGTGGAGGTAGGAGGG - Intronic
1119758091 14:77132906-77132928 TGATGGGAAGGCAAGGAAGAAGG - Exonic
1119778275 14:77261436-77261458 TGTTTGGAGGGGAGGGAAGAGGG - Intergenic
1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG + Intronic
1119895909 14:78219918-78219940 GGATGGGGATGGAGGGTAGAAGG + Intergenic
1119937292 14:78603512-78603534 TGGTAGGAAAGGACAGAAGATGG + Intronic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1120515605 14:85465926-85465948 TGGTGAGAGAGGAGGCAAGACGG - Intergenic
1120928113 14:89818466-89818488 AGGGAGGAAGGGAGGGAAGAAGG + Intronic
1121252784 14:92512565-92512587 TGGTGGAAATCCAGGGAAGATGG + Intergenic
1121492741 14:94371783-94371805 TGGTGGGAGTGGTCGGGAGAAGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121691938 14:95884283-95884305 TGGTGGGAGAGGAGGTGAGATGG - Intergenic
1121715895 14:96074022-96074044 TGTTGGGAAGGGTGGGAAGAGGG + Intronic
1122096511 14:99376608-99376630 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
1122401095 14:101467862-101467884 TGGGGAGGATGGAGAGAAGAGGG + Intergenic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122609208 14:102969707-102969729 TGGTGGGGCTGGAGGGTAGCAGG - Intronic
1123025717 14:105422794-105422816 TGGTGAGCAGGGAGGGAACAGGG + Intronic
1123168473 14:106349007-106349029 TGGTAGGAAAGGAAGGAGGAAGG - Intergenic
1123457028 15:20435633-20435655 TGGTGGGTGGGGAGGGAAAAAGG - Intergenic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1123661034 15:22564726-22564748 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1123989224 15:25671051-25671073 TAGTGGGAAGGGAGGGGATAAGG + Intergenic
1124035999 15:26054107-26054129 TGCTGGGCATAGAGGGAGGATGG + Intergenic
1124263182 15:28210786-28210808 TGGTGGGTGGGGAGGGAAAAAGG - Intronic
1124314835 15:28658960-28658982 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124614828 15:31234088-31234110 TGGTGGGATTGGAAGGATGGAGG + Intergenic
1124719426 15:32098593-32098615 TGGTGGGAACCGAGGGATAAAGG + Intronic
1124803702 15:32860222-32860244 AGGTAGGAAGGGAGGGAGGAAGG + Intronic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1124961175 15:34396791-34396813 TGGTGGGGTTGGCGGGGAGAGGG - Intronic
1124977805 15:34543012-34543034 TGGTGGGGTTGGCGGGGAGAGGG - Intronic
1125294261 15:38185198-38185220 TAGAGGAAATGGAGGGAGGAGGG + Intergenic
1125401319 15:39306646-39306668 TGGTGAGGATGTAGGGAAAAAGG - Intergenic
1125513349 15:40304470-40304492 AGGTGTTCATGGAGGGAAGAAGG - Intronic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125843087 15:42824024-42824046 TGGTGTGAAAGGAAGCAAGAAGG + Intronic
1126667188 15:51086210-51086232 TGGTGAGAGAGGAGAGAAGAAGG - Intronic
1126977726 15:54203185-54203207 TGGTGGGGATGCAGTGAAAAGGG + Intronic
1127013279 15:54653876-54653898 TAATGGGAAAGAAGGGAAGAAGG - Intergenic
1127492703 15:59480047-59480069 TGGTGGAGATGGGGAGAAGATGG + Intronic
1127517818 15:59713404-59713426 AGGAGGGAAGGGAGGAAAGAAGG - Intergenic
1127574482 15:60277297-60277319 AGGTGGGAAAGGATGGGAGAGGG + Intergenic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1127842687 15:62844646-62844668 TCATGGGAATGGGAGGAAGATGG + Intergenic
1127897055 15:63310472-63310494 AGGTTGGAAAGGAGAGAAGAAGG + Intergenic
1127920168 15:63488148-63488170 AGGTGGAAAGGGAGGGAGGAGGG - Intergenic
1128514827 15:68335655-68335677 GGGCCGGGATGGAGGGAAGAGGG - Intronic
1128739638 15:70074600-70074622 TGCTGGTGCTGGAGGGAAGAGGG + Exonic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1130108001 15:80943363-80943385 TGCTGGGAGTGTAGTGAAGAGGG - Intronic
1130300473 15:82676644-82676666 TTGTGGGAGAGGAGTGAAGATGG + Intronic
1130378407 15:83351028-83351050 TGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1130379904 15:83362654-83362676 TGGGGTGACTGGAGGGCAGAGGG - Intergenic
1130392111 15:83466030-83466052 AGGAGGGAATGGAGGCAGGAAGG - Intronic
1130476056 15:84268699-84268721 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130483477 15:84382753-84382775 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130549088 15:84878376-84878398 TGGTGGGATTTGAGGGACAACGG + Intergenic
1130658783 15:85813490-85813512 TGGTGGAAAGAGTGGGAAGAGGG - Intergenic
1130839216 15:87682050-87682072 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
1130941264 15:88511230-88511252 TGGAGGGAATAGAGAGTAGAGGG - Intergenic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131399111 15:92110466-92110488 AGGTGGGCGTGGAGGGAACAGGG - Intronic
1131793329 15:95988380-95988402 AGAAGGGAAGGGAGGGAAGAGGG + Intergenic
1132264387 15:100455097-100455119 TGGTGAGAATGTAAAGAAGAGGG + Intronic
1132394783 15:101464654-101464676 TGCTGGGAATGCAGGGAAATGGG + Intronic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1132772932 16:1574685-1574707 AGGTGGGAAGGGAGGCAGGAGGG - Intronic
1132988329 16:2779595-2779617 TGGTGGGAATGGGGTCAGGAGGG + Intergenic
1133085167 16:3356551-3356573 TAGTGGGACTGCAGTGAAGAAGG - Exonic
1133325176 16:4937571-4937593 TGGTGGCAATTGAGGGAAGGGGG + Intronic
1133656711 16:7872049-7872071 GGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1133663052 16:7937510-7937532 GGGGAGGAAGGGAGGGAAGAAGG - Intergenic
1133839289 16:9394109-9394131 TGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1134288619 16:12884247-12884269 GGGTGGGAAGGGTGGGAAGGGGG + Intergenic
1134449117 16:14353103-14353125 TGGTGTGAATGAATGTAAGACGG - Intergenic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1134792011 16:16997596-16997618 TGGGAGGCGTGGAGGGAAGAGGG - Intergenic
1134860986 16:17560605-17560627 TGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1134867300 16:17619891-17619913 TGGTGGGAAGGAAGGAAAAAGGG - Intergenic
1135254441 16:20929762-20929784 AGGTGGGGATGTAGGGAAGGTGG - Intergenic
1135262948 16:20997237-20997259 TGCTGGGGATGGAGGGAAAGAGG + Intronic
1135353337 16:21749025-21749047 TCATGGGAATAGTGGGAAGAAGG + Intronic
1135451824 16:22565148-22565170 TCATGGGAATAGTGGGAAGAAGG + Intergenic
1135681790 16:24463476-24463498 TGGGGGGAAAGGAGGGGAGATGG + Intergenic
1135861415 16:26059255-26059277 TGGAGGGAAAGGAAGGAGGAAGG - Intronic
1135948627 16:26890319-26890341 TGGTGTGAATGAGGGGAAAAGGG - Intergenic
1136043127 16:27595972-27595994 TGGTGGGAGAGGAGGACAGAGGG + Intronic
1136597605 16:31262310-31262332 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
1136932336 16:34430646-34430668 TGGGGGGAAGAGAGGGAGGAAGG - Intergenic
1136972236 16:34981168-34981190 TGGGGGGAAGAGAGGGAGGAAGG + Intergenic
1137225244 16:46498769-46498791 TAGTGGGAATGGAGTGAGTAGGG - Intergenic
1137587838 16:49674749-49674771 AGATGGGAAGGCAGGGAAGAGGG + Intronic
1137614026 16:49836367-49836389 GGGTTGGCATGGAGGGAAGGGGG + Intronic
1137961402 16:52885385-52885407 GGATGGGAAAGGAGGGAAGCAGG - Intergenic
1138186429 16:54981259-54981281 TGGTGGAAAGGGAGGGAGGCTGG - Intergenic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138251543 16:55505653-55505675 TGGTGGGATTGGAGGGGGAAGGG - Exonic
1138318317 16:56089374-56089396 AGGTGGGAATGGAGCTCAGAGGG + Intergenic
1138445405 16:57060168-57060190 TGGAGTGAATGGAGGGGAGGAGG - Intronic
1138506263 16:57479819-57479841 GGGAGGGAAGGGAAGGAAGAAGG - Intronic
1138656453 16:58494395-58494417 TGGAAGGAAGGGAGGGAAGGGGG - Intronic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139240735 16:65389401-65389423 AGGAAGGAATGGAGGGAGGAAGG - Intergenic
1139336528 16:66235772-66235794 TGGTTGCATTGCAGGGAAGATGG + Intergenic
1139375758 16:66495405-66495427 TGGAGGGAAGGAAGGAAAGAAGG - Intronic
1139375783 16:66495492-66495514 TGGAGGGAAGGAAGGAAAGAAGG - Intronic
1139375806 16:66495571-66495593 TGGAGGGAAGGAAGGAAAGAAGG - Intronic
1139657792 16:68399487-68399509 TGCCTGGAATGGAGGGAAGTAGG + Intronic
1140800994 16:78488162-78488184 GGCTGGGGATGGAGGGAACATGG + Intronic
1140967683 16:79983063-79983085 TGGCAGGGATGGAGGGAGGAAGG - Intergenic
1141033736 16:80610986-80611008 TGGTGAGGATGGTGGGGAGAGGG - Intronic
1141126404 16:81403962-81403984 TGCTGCAAATGGAGGGAAGGTGG - Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141610587 16:85178876-85178898 GGGTGGGCAGGGAGGGATGAGGG + Intronic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141914332 16:87084179-87084201 TGGTGAGCTTGGATGGAAGAAGG + Intronic
1142561311 17:811134-811156 AGGTGGCACAGGAGGGAAGAAGG + Intronic
1142781328 17:2183238-2183260 AGGCAGGAAGGGAGGGAAGAAGG + Intronic
1142964694 17:3573286-3573308 GGGTGGTCCTGGAGGGAAGAAGG - Intronic
1143021203 17:3917995-3918017 GGGAGGGAACGGAGGGAGGAAGG + Intergenic
1143096429 17:4480850-4480872 AGGTGGGAAGGCAGGGAAGGGGG - Intronic
1143181345 17:4986285-4986307 TGCTGGGAAGGGAGAGAACAAGG + Exonic
1143239680 17:5433518-5433540 AGGTGGGGAGTGAGGGAAGAGGG - Intronic
1143278376 17:5731456-5731478 AGGTGGGATGGGAGGGAAGGAGG + Intergenic
1143316009 17:6033963-6033985 TGGTGGTAGTGGAGGGAATTGGG + Intronic
1143508974 17:7384787-7384809 GAGAGCGAATGGAGGGAAGAGGG - Intronic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143540373 17:7564935-7564957 TGGTGGAAAGGGAGAGAGGAGGG - Intronic
1143702091 17:8668232-8668254 TGGGAGAAATGGAGAGAAGATGG - Intergenic
1143904769 17:10199255-10199277 GGGACGGAATGGAGAGAAGACGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144183250 17:12772039-12772061 TGGTGGAAATGGAGAGACAAAGG + Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144350278 17:14388595-14388617 AGGTGGGGATAGAAGGAAGAGGG + Intergenic
1144763835 17:17722444-17722466 TGCTGGGACTGCAGCGAAGAGGG + Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1146262445 17:31430894-31430916 TGGCAGGAAGGGAGGGAGGACGG + Intronic
1146302777 17:31703392-31703414 TGGTGAGAATGTAGAGAAAAGGG - Intergenic
1146422210 17:32698277-32698299 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1146795237 17:35775747-35775769 GGGTGGAAAAGGAAGGAAGAGGG - Intronic
1146817573 17:35955426-35955448 TGGTGGGAATGGAGGCAGTGGGG + Intergenic
1146918360 17:36692610-36692632 TGGGGGGAAGGGTGGGAGGAAGG - Intergenic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147916472 17:43890512-43890534 GGGTTGGAGTGGAGGGCAGAGGG - Intronic
1147979094 17:44263689-44263711 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
1148391499 17:47276150-47276172 GGGTTGGAAAGGAGGGAAGGAGG - Intronic
1148393674 17:47291555-47291577 TGGTGGGAGGGGAGGAAGGAGGG + Intronic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148794961 17:50192533-50192555 AGGTGGGAAATGGGGGAAGAAGG + Intronic
1149682479 17:58515778-58515800 TGGAAGGAAGGGAGGGAAGGAGG + Intronic
1149884994 17:60330893-60330915 TGCCTGGAATGGAGGGGAGAAGG - Intronic
1150006579 17:61473535-61473557 TGGGAGGAAAGGAGGAAAGAGGG - Intronic
1150379066 17:64706488-64706510 TGGCTGGAATGGAGTGAGGACGG - Intergenic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1150500682 17:65648132-65648154 TGATGGGAATGGAGAGAGGATGG - Intronic
1150582508 17:66487653-66487675 TGGTGGGGATGCAGAGAAAAGGG - Intronic
1150734716 17:67727083-67727105 TGGTGGGTAAGGAGGCAAGGTGG - Intronic
1150929881 17:69573098-69573120 GGGAGGGAGGGGAGGGAAGAGGG - Intergenic
1150947589 17:69765343-69765365 GGGAGGGAAGGGAAGGAAGAGGG - Intergenic
1151102717 17:71574249-71574271 TGGTGAGAGTGGAGTGAGGATGG + Intergenic
1151115177 17:71727513-71727535 AGGTGGGAAGGAAGGAAAGAAGG - Intergenic
1151150955 17:72086462-72086484 TGGTGGGGATGGGAGGAGGAAGG - Intergenic
1151336585 17:73443604-73443626 TGGAAGGAATGGAGGAGAGATGG + Intronic
1151345720 17:73500199-73500221 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151345753 17:73500321-73500343 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151345782 17:73500436-73500458 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151345884 17:73500873-73500895 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151393101 17:73801220-73801242 GGGAGGGAATGGAAGGAGGAAGG - Intergenic
1151426253 17:74032799-74032821 TGGTTGAACTGGAGGGAAGTCGG - Intergenic
1151502195 17:74497700-74497722 TGGTGGGAAGTGAGGGCGGAGGG + Intergenic
1151569828 17:74920727-74920749 TGGAGGGAGTGGAGGGGGGAGGG + Intronic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1151981090 17:77509305-77509327 TGATGGTAATGAAGGGATGATGG - Intergenic
1151991068 17:77574650-77574672 TAATGGGAATGATGGGAAGAAGG - Intergenic
1152118785 17:78405469-78405491 TGGTGGGGGTGGTAGGAAGAGGG + Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152807603 17:82363879-82363901 TGGTGGGAACAGAGGATAGAAGG + Intergenic
1153049642 18:889670-889692 TGGTGGGAATGGAGAGAGTTGGG + Intergenic
1153062646 18:1010008-1010030 TGGTGAGACTGAAGGGAACAAGG - Intergenic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153564268 18:6404091-6404113 TGGGGGGAAGGGTGGGAGGAGGG + Intronic
1153577472 18:6536978-6537000 TCCTGGGAATGGAGGGCTGAAGG + Intronic
1153634344 18:7100357-7100379 TGGTAAGAATGTGGGGAAGATGG + Intronic
1153841343 18:9010877-9010899 TGGTGGGGAGGGAGGGAGGGGGG + Intergenic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1155612630 18:27684185-27684207 GGGTGGGAATGAATGGAAGAGGG - Intergenic
1155810660 18:30229582-30229604 TGGTGGGGATGTGGGGAAAAAGG + Intergenic
1156071955 18:33222312-33222334 AGGAAGGAAGGGAGGGAAGAAGG - Intronic
1156178735 18:34578100-34578122 TGGTGTGGATGCAGTGAAGAGGG - Intronic
1156504749 18:37582717-37582739 TGATGGGGATGGAGGGAAAATGG - Intergenic
1156771700 18:40735565-40735587 TGGGGTGAAGGGAGGGAAGAGGG - Intergenic
1156850984 18:41725958-41725980 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1156886575 18:42141856-42141878 TGGTGGCAGGGGAGGGGAGATGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157639679 18:49202035-49202057 TGTTGGGTAAGAAGGGAAGATGG - Intronic
1157663998 18:49470019-49470041 TGGTGGGTATGGAGGAAGGTAGG - Intergenic
1157866337 18:51188622-51188644 TGCTGGGAATAAAGGCAAGAGGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158080633 18:53586002-53586024 TGGTGAGAATGTAGAGAAAAGGG - Intergenic
1158153112 18:54394441-54394463 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1158409075 18:57188439-57188461 AGATGGGAATGGAACGAAGATGG + Intergenic
1158471755 18:57743333-57743355 TGTGGGGAAGGGAGGGAAGTAGG - Intronic
1158528177 18:58234263-58234285 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1158626777 18:59078437-59078459 TGGTGGGAATGGAGGGATCAGGG + Intergenic
1158683059 18:59586265-59586287 TGGTTGAAATGGAAAGAAGAGGG - Intronic
1158789038 18:60752800-60752822 TGGTGAGAATGTAGAGAAAAGGG + Intergenic
1159225937 18:65536140-65536162 TGGTGGGGATGCAGTGAAAAGGG + Intergenic
1159356114 18:67338437-67338459 AGGGAGGAAAGGAGGGAAGAAGG - Intergenic
1159487448 18:69082495-69082517 AGGGGGGAAGGAAGGGAAGAAGG + Intergenic
1159881082 18:73859122-73859144 AGGGGGGCATGCAGGGAAGAAGG + Intergenic
1160123917 18:76153529-76153551 TGGTGGAAATGGAGGTGACAGGG + Intergenic
1160295022 18:77630008-77630030 TGGGAGGAAAGGAGGGAAGGAGG - Intergenic
1160324475 18:77930718-77930740 TGGAGGGAGTGGAGGGATGGAGG - Intergenic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161141617 19:2651347-2651369 TGGAGGGAAGGGAGGGAGGGAGG - Intronic
1161141628 19:2651372-2651394 TGGAGGGAAGGGAGGGAGGGAGG - Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161627899 19:5337778-5337800 TGGTGGAAATTGGGGGAAAATGG + Intronic
1161851792 19:6740974-6740996 TGGTGGGGGAGGAGGGGAGAGGG - Intronic
1161884875 19:6986796-6986818 TGGTGAGAATGTAGAGAAAATGG + Intergenic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1161955911 19:7495020-7495042 GGGAGGGAAAGGAAGGAAGAAGG - Intronic
1161955932 19:7495092-7495114 GGGAGGGAAAGGAAGGAAGAAGG - Intronic
1162104713 19:8363493-8363515 AGGTAGGGAGGGAGGGAAGAAGG - Intronic
1162157784 19:8691409-8691431 TGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1162793311 19:13074050-13074072 TGGGGGGAGTGGAGAGAAGATGG - Intronic
1162927753 19:13938559-13938581 GGGTGGGGATGGAGGGATGGGGG + Intronic
1163207267 19:15812727-15812749 AGGGAGGAATGGAGGGAGGAAGG + Intergenic
1163229424 19:15990135-15990157 TGGTGGGGTTGGGGGGAGGATGG + Intergenic
1163684728 19:18704931-18704953 GGGAGGGAATGGAGGGTAGTAGG - Intronic
1164449156 19:28345066-28345088 AGGTGGGAATGGAGGGGTGTGGG + Intergenic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164888781 19:31805346-31805368 AGGCGGGAATGGGGGGAGGAGGG + Intergenic
1164975629 19:32570953-32570975 AGGTAGGAAGGGAGGGAAGGAGG - Intergenic
1165460964 19:35944269-35944291 TGGTGGGACTAGAGTGAAAATGG + Intronic
1165491500 19:36126043-36126065 AGGTGGGAATGATGAGAAGATGG - Intergenic
1165654782 19:37523729-37523751 TGTTGTGAATGGAGGCAAGGAGG + Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166008690 19:39925489-39925511 TGGAGGGAAGGTAGGGAAGAGGG - Intronic
1166347983 19:42178143-42178165 TGGGGGGAGAGGAGGGAGGAGGG + Intronic
1166424968 19:42669583-42669605 TGGTGGTAAAGGAAGTAAGAAGG - Intronic
1166749019 19:45155975-45155997 TGGGGGCCATGGAGGGCAGATGG - Intronic
1166829465 19:45630095-45630117 TGGTGGGCATGGGGGGAGGATGG - Intronic
1166929973 19:46296635-46296657 GGGTGGGATTGGAGGTCAGAGGG + Intergenic
1167043970 19:47039377-47039399 TGGTGGGCATGGTTGGAGGAGGG - Intronic
1167418547 19:49389789-49389811 TGGGTGGAATGGAGGCAGGATGG + Intronic
1167436520 19:49481563-49481585 AGGTGGGCCAGGAGGGAAGAAGG + Intronic
1167727642 19:51227352-51227374 TGGTGAGGATGTAGAGAAGAGGG - Intronic
1167789716 19:51666669-51666691 AGGTAGGAAGGGAGGGAGGAAGG + Intergenic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168091616 19:54089215-54089237 TGCTGGGATTAGAGGAAAGAAGG + Intergenic
1168184752 19:54692570-54692592 GGCTGGGAAGGGTGGGAAGAGGG + Intronic
1168387110 19:55973463-55973485 ATGTGGGAATGGTGGGATGAAGG - Intronic
1168456251 19:56511018-56511040 TGGTGGGGATTGAGTGAAGAAGG + Intronic
1168526087 19:57089878-57089900 TGGAGGACACGGAGGGAAGACGG + Intergenic
925171107 2:1750741-1750763 TGGGGAGAAGGGAGGGAAGGAGG - Intergenic
925199201 2:1952758-1952780 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
925974489 2:9132163-9132185 TGGAGGCCAAGGAGGGAAGATGG + Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926191577 2:10732206-10732228 AGGGAGGGATGGAGGGAAGAAGG - Intronic
926542850 2:14202929-14202951 AGGAAGGAATGGAGGGAGGAAGG + Intergenic
926648093 2:15311962-15311984 TGGAGGGACTTGAGGAAAGAGGG - Intronic
926811756 2:16761014-16761036 TGGTGGGAATGCAGTGAGGAAGG - Intergenic
927143483 2:20145405-20145427 TGGCGGGAAAGGAGAGAAGCTGG - Intergenic
927287269 2:21369826-21369848 AGGAGGTAATGGAGGGAAGGAGG - Intergenic
927332341 2:21880294-21880316 TTGTGGGAATGTAGGAAATATGG - Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927622873 2:24680576-24680598 TGGGGGGATTGGAGGGATGTTGG + Intronic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
927827551 2:26319121-26319143 AGATGGGATGGGAGGGAAGAGGG + Intronic
927846385 2:26474492-26474514 AGGTGGGACTGCAGGGAAGAGGG - Exonic
928394910 2:30936165-30936187 TGGGGGGAATGGAGGGCGGGAGG - Intronic
928403522 2:30996558-30996580 TGGTGTGAATAGAGAGTAGAGGG - Intronic
928406949 2:31022181-31022203 GGGGAGGAAGGGAGGGAAGAAGG + Intronic
928426608 2:31183779-31183801 AGGAAGGAAAGGAGGGAAGAAGG - Intronic
928697600 2:33865490-33865512 TGGGGGGAAGGGAGGGAAACAGG + Intergenic
928704468 2:33933259-33933281 AGGTGAGAAAGAAGGGAAGAAGG - Intergenic
928785875 2:34885487-34885509 TAGAGGGAATGGAGGAAAGTGGG - Intergenic
929537025 2:42790154-42790176 TGGGAGGCATGGAGGCAAGACGG + Intronic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
929734898 2:44537531-44537553 TGGTGAGGATGGAGAGAAAAGGG + Intronic
929787169 2:45001319-45001341 TGGTGAGCAGGAAGGGAAGAAGG - Intergenic
930107800 2:47653716-47653738 AGGAAAGAATGGAGGGAAGAGGG - Intergenic
930218353 2:48720342-48720364 TGATGGGAGTGGAGTGAAGTAGG - Intronic
930330867 2:49981389-49981411 TGAAGGGGAGGGAGGGAAGAGGG + Intronic
930570824 2:53084638-53084660 TGGTGGGAAGGGTAGGAGGAAGG + Intergenic
930676742 2:54209752-54209774 TGGCAGGAATAGAGTGAAGATGG - Intronic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931389961 2:61833054-61833076 TGGTGGGGAATGAGGGAAGGTGG + Intronic
931769900 2:65488433-65488455 TGGTGTGAAAGGAAGGAAGATGG - Intergenic
931924030 2:67051689-67051711 GGGAGGGAAGGGAGGGATGAAGG - Intergenic
931928021 2:67096369-67096391 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
932011607 2:67983523-67983545 TGGTGAGGATGGAGGGATAAGGG - Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932297798 2:70641571-70641593 TTATGGCAATGGAGGGGAGAAGG - Intronic
932333749 2:70917496-70917518 TGGTGAGGATGCAGGGAAGCTGG - Intronic
932430368 2:71670538-71670560 AGGTGGGAGTGGAGAGAGGAGGG - Intronic
932465590 2:71922153-71922175 TGGGGGGACTGGAGAGAAGAGGG - Intergenic
932518842 2:72385868-72385890 TGGTGAGAATGTGGAGAAGAGGG + Intronic
932631163 2:73344644-73344666 TGGTGGGACAAGAGGCAAGAGGG - Intergenic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933127894 2:78634169-78634191 CGGGAGGAAGGGAGGGAAGAAGG + Intergenic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
933708473 2:85308478-85308500 GGGGGGGAAGGGAGGGAAGGAGG - Intronic
933999027 2:87691279-87691301 TGGTGAGAATGTAGGGAAACTGG - Intergenic
934056111 2:88252971-88252993 GGGAGGGAAGGGAGGGAGGAAGG - Intergenic
934521329 2:95021971-95021993 GGATGGGGATGGAGGGTAGAGGG - Intergenic
934560893 2:95312792-95312814 TGGTGGGAGCTGAGGGACGAGGG + Intronic
934583727 2:95469484-95469506 TCGTGGAAATACAGGGAAGAAGG + Intergenic
934595725 2:95607230-95607252 TCGTGGAAATACAGGGAAGAAGG - Intergenic
935373962 2:102376682-102376704 TGGTGGGAGGGGAGGGATGATGG + Intronic
935432417 2:102990357-102990379 TGATGGGCAAGGAGGGAAGGAGG + Intergenic
935491484 2:103725881-103725903 TGGTGAGATTGTAGGGAAAAGGG - Intergenic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
935692020 2:105740586-105740608 TTCTGGGAATGGAGGGACCAAGG + Intergenic
935796438 2:106645642-106645664 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
935976877 2:108586909-108586931 AGGTGGGAGTGGAAGGCAGATGG - Intronic
935985453 2:108668349-108668371 TGGAGGGGATGGGGAGAAGATGG - Intronic
936118508 2:109721842-109721864 TGGTGGGAATTGGGGCAAGGTGG - Intergenic
936137883 2:109911996-109912018 TGGAGGGGATGGGGAGAAGATGG - Intergenic
936206814 2:110459489-110459511 TGGAGGGGATGGGGAGAAGATGG + Intronic
936294817 2:111259604-111259626 TGGTGAGAATGTAGGGAAACTGG + Intergenic
936333931 2:111572928-111572950 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
936333943 2:111572961-111572983 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
936503026 2:113081505-113081527 AGGTGGGAGTAGTGGGAAGAGGG + Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937038615 2:118803383-118803405 GGGTGGGAATGGAGCAAGGATGG - Intergenic
937236130 2:120432831-120432853 TGGAAGGAATGGAGGGAGGCTGG + Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937332026 2:121037650-121037672 TGGTTGGATGGGAGGGAAGTTGG - Intergenic
937662063 2:124442267-124442289 TGGTGGCAGTGGATGCAAGAAGG + Intronic
937981663 2:127619418-127619440 TGGTTGGATTGGAGGAATGAAGG + Intronic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938191444 2:129285414-129285436 TGGTGAGAATGGGGAGAAGCTGG - Intergenic
938306898 2:130262738-130262760 TGCAGGGAAAGGAGGGCAGAGGG - Intergenic
938563823 2:132498707-132498729 TGGTGGGGATGCAGTGAAAAGGG - Intronic
938677065 2:133647546-133647568 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
938913520 2:135909583-135909605 TTGTTGGAATGGGGAGAAGATGG - Intronic
938939901 2:136161054-136161076 TGATTGGCGTGGAGGGAAGATGG + Intergenic
939081185 2:137663647-137663669 TGGAAAGAATGGAGGGAAGGAGG + Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939302869 2:140368957-140368979 AGGTGTGAATGGAGGGGAAAGGG + Intronic
939411739 2:141835494-141835516 TGGGGGGAGGGGAGGGAAGGTGG + Intronic
939682623 2:145157538-145157560 TGCAGGGAACAGAGGGAAGAGGG - Intergenic
939733849 2:145819312-145819334 AGGAGGGGATGGAGGGAGGAAGG - Intergenic
939897670 2:147811125-147811147 TGGTGGGAATGTGGGGTAGCAGG - Intergenic
940032160 2:149274930-149274952 TTGTGGGAATGGACTGAAGGAGG + Intergenic
940656132 2:156489849-156489871 AGGAAGGAAGGGAGGGAAGAAGG - Intronic
941114323 2:161454277-161454299 TGGGAGGGATGGAGGGAAGAAGG - Intronic
941170706 2:162132392-162132414 TAGTGGGAGTGCAGGGGAGAAGG - Intergenic
941546071 2:166853651-166853673 TGGTGAGAATGGGGAGAAAATGG + Intergenic
941565693 2:167103169-167103191 AGGAGGGAAGGGAGGGGAGAGGG + Intronic
942099231 2:172562029-172562051 TGCTGGGAATGAATGGTAGAAGG - Intronic
942478212 2:176352351-176352373 TGGTGGGGATGCAGTGAAAAGGG - Intergenic
942529902 2:176898391-176898413 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
942560517 2:177213346-177213368 GCCTGGGATTGGAGGGAAGAGGG + Intronic
942602411 2:177654823-177654845 TGGGAGGAAAGGAGGGAGGAAGG - Intronic
942763800 2:179430146-179430168 TGGAGGGAATGGGGAGACGATGG + Intergenic
942865326 2:180666668-180666690 TGGTGGGAGTGGGGAGAAAAGGG + Intergenic
943499242 2:188666161-188666183 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
943581340 2:189687102-189687124 TGGTGGGGCAGGAGGGAAGTGGG - Intronic
943662531 2:190574776-190574798 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
944335296 2:198526597-198526619 AGGTGGGAAGGCAGGGAGGATGG + Intronic
944486829 2:200215686-200215708 AGTGGGGAAGGGAGGGAAGAGGG - Intergenic
944621147 2:201517173-201517195 TGGTGGGGAGGTGGGGAAGAAGG - Intronic
944762491 2:202831423-202831445 AGTTGGGAGTGGAGGGAAGGAGG - Intronic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
944923914 2:204443342-204443364 TGGATGGATGGGAGGGAAGATGG + Intergenic
944996185 2:205296722-205296744 TTTTGGGAATGGAGGGTAGTAGG + Intronic
945282874 2:208052867-208052889 GGGTGGGACTAGAGGGAAAATGG - Intergenic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
945838853 2:214864834-214864856 TGGGGGGAAGGAAGGGACGATGG + Intergenic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946109737 2:217404111-217404133 GGGAGGGGAGGGAGGGAAGAAGG - Intronic
946176810 2:217927333-217927355 TGGAAGGGATGAAGGGAAGAAGG + Intronic
946512059 2:220368673-220368695 TGGTGAGAATGTAGACAAGAGGG + Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
946899937 2:224362321-224362343 AGGTGGGAAGGAAGGGAAGGAGG + Intergenic
947006053 2:225512640-225512662 TGGGAGGAAGGGAGGGAGGAAGG - Intronic
947077898 2:226364345-226364367 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
947289549 2:228557207-228557229 TGGTGGAAATGGAAAGAAGAGGG - Intergenic
947304876 2:228734467-228734489 TAGGGGGAATGGAGGGGAAATGG - Intergenic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
947909151 2:233790371-233790393 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
947960898 2:234236351-234236373 GGGTGGAAAGGGAGGGAGGAAGG - Intergenic
947966944 2:234289831-234289853 TGGTGAAAATGGAGGCAGGAGGG - Intergenic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948463996 2:238143526-238143548 TGGCGGGAAAGGAGGCATGAGGG + Intronic
949071403 2:242027138-242027160 TGGGGAGAATGGAGAGAAGCAGG - Intergenic
1168744072 20:221336-221358 GGGAGGGAATGGAGGGAAGGAGG + Intergenic
1169140872 20:3226949-3226971 TGGTGGCGATGGAGGGAGGTGGG - Intergenic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1169409756 20:5357868-5357890 TGGTGAGGAAGGAGGGAAAATGG + Intergenic
1169855872 20:10102243-10102265 AGGTGGAAAGGGAGGCAAGAGGG - Intergenic
1170107897 20:12771816-12771838 TGGTGGGAATGAAGGGCTAATGG + Intergenic
1170148837 20:13206562-13206584 TGGTGAGACAGGAGGGAGGAAGG + Intergenic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1170501806 20:16982418-16982440 AGGAGGGAAGGGAGGGAGGAGGG - Intergenic
1170620707 20:17993633-17993655 TGGCGGGAAGGGAGGCAGGAAGG - Intronic
1170830484 20:19835153-19835175 AGGAAGGAATGAAGGGAAGAAGG + Intergenic
1171035920 20:21712997-21713019 TGGAGGGAATGGAGGGCAGGAGG + Intronic
1171151867 20:22834710-22834732 AGGAAAGAATGGAGGGAAGAAGG - Intergenic
1171151904 20:22834857-22834879 AGGAAAGAATGGAGGGAAGAAGG - Intergenic
1171151954 20:22835097-22835119 AGGAAAGAATGGAGGGAAGAAGG - Intergenic
1171232739 20:23500506-23500528 TGGTGGAATGGGAGGCAAGAGGG + Intergenic
1171252902 20:23663050-23663072 AGGTGGGAATGGAGGTAGAAAGG - Intergenic
1171259385 20:23718367-23718389 AGGTGGGAATGGAGGTAGAAGGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171460910 20:25297479-25297501 TGGTGGAAAGGGAGGGAGAATGG - Exonic
1171958730 20:31478180-31478202 GGGTGGGAGGGGTGGGAAGAGGG - Intronic
1172007433 20:31827014-31827036 TGGAGGGATGGGAGGGCAGAGGG - Intronic
1172036000 20:32011089-32011111 GGGTGGAAATGGGGGTAAGATGG - Intronic
1172113970 20:32563015-32563037 TGGAGGGGAAGGAGGGTAGAGGG + Intronic
1172374811 20:34429911-34429933 TAGAGGAATTGGAGGGAAGAAGG + Intronic
1172614180 20:36272781-36272803 TGCTGGGAACGGAGGAGAGATGG + Intergenic
1172674718 20:36660306-36660328 GGGTTGGAAGTGAGGGAAGAAGG + Intronic
1172687772 20:36769986-36770008 TGGGGTGCAGGGAGGGAAGAGGG + Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172782720 20:37446787-37446809 TGGAAAGAAAGGAGGGAAGAAGG - Intergenic
1172989823 20:39026548-39026570 TGGAAGGAATGCCGGGAAGAAGG + Intronic
1173038498 20:39436070-39436092 TCGTGGGCATGGAGAGTAGAAGG - Intergenic
1173223909 20:41150658-41150680 GGATGAGAAGGGAGGGAAGATGG - Intronic
1173687065 20:44931163-44931185 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
1173900789 20:46587434-46587456 TGGTGGGAAGGAAGGAAAGCGGG - Intronic
1174009946 20:47441754-47441776 GGAGGGGAAGGGAGGGAAGATGG - Intergenic
1174226735 20:49006737-49006759 TGGCTTGAATGGAGGGAACAAGG + Intronic
1174308542 20:49632322-49632344 AGTTGGGAATGTAGGGAAGGTGG - Intergenic
1174701126 20:52610777-52610799 TGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1174894355 20:54433166-54433188 TGTTGGGGGAGGAGGGAAGAAGG - Intergenic
1175137588 20:56836480-56836502 TGGTTGGAAAGGAGGTAAGCTGG - Intergenic
1175381524 20:58567464-58567486 TGGTGGGAATGAAGGGGACAGGG + Intergenic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1175474960 20:59265615-59265637 AGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1175563849 20:59956549-59956571 TGGGGGGAAGAGTGGGAAGAGGG - Intergenic
1175615010 20:60390506-60390528 AGGAAGGAATGAAGGGAAGAAGG - Intergenic
1175702269 20:61148208-61148230 TGCTGGGAATTGAGAGAAGAGGG + Intergenic
1175893858 20:62327462-62327484 AGGTGGGACTGGATGCAAGATGG - Intronic
1175983997 20:62755228-62755250 AGGAGTGAATGGAGGGAAGGAGG - Intronic
1176115688 20:63430978-63431000 GGGTGGGGATGGAGGCACGAGGG + Intronic
1176429006 21:6564754-6564776 TGCAGGGAATGGAGGGAGGCCGG + Intergenic
1176513702 21:7767452-7767474 GGGAGGGAAGGGAGGGAGGAAGG - Intronic
1177004746 21:15657609-15657631 TGGGGGGAATGGATGGAAGGGGG - Intergenic
1177264583 21:18765788-18765810 TGGAAGGGATGAAGGGAAGAGGG - Intergenic
1177461718 21:21420764-21420786 TGGAAGGAATTGATGGAAGAAGG + Intronic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178443354 21:32616503-32616525 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1178647815 21:34397976-34397998 GGGAGGGAAGGGAGGGAGGAAGG - Intronic
1178666862 21:34555625-34555647 TGGTGGGAAGTGTGGGAAGGAGG + Intronic
1179331441 21:40406157-40406179 TGGTGAGAATGTAGAGAAAAGGG + Intronic
1179562078 21:42221833-42221855 TGGTGGAAATGGAGTGAATGCGG + Intronic
1179704495 21:43173070-43173092 TGCAGGGAATGGAGGGAGGCCGG + Intergenic
1180729380 22:17970186-17970208 TGGTGAGAAGGGAGGACAGATGG + Intronic
1180748616 22:18109928-18109950 TGGGGGGAAGTGAGGGGAGATGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181487570 22:23241316-23241338 GGGGGGGAATGGCAGGAAGAGGG - Intronic
1181495369 22:23284521-23284543 AGGTTGGAATGGAGCAAAGAGGG + Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1182067705 22:27442357-27442379 TGCTGGGAATGGGGGGGAAAGGG - Intergenic
1182081412 22:27531698-27531720 AGCTGGGAGTGGAGGGAAAAGGG + Intergenic
1182090895 22:27594137-27594159 GGGAGGGACTGGAGGGAGGAAGG + Intergenic
1182479194 22:30595747-30595769 TGGTCTGAATGGAGGGAATCAGG - Intronic
1183002839 22:34875921-34875943 TGATGAGGATGGAGGGAAGGGGG + Intergenic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183625699 22:39000011-39000033 TGGAGGAAATGGAGAGAGGATGG - Intergenic
1183730461 22:39615612-39615634 TGGGGAGAGAGGAGGGAAGAGGG - Intronic
1183848479 22:40562754-40562776 AGGGGGGAATGGAGGGAGGGAGG + Intronic
1183875242 22:40774939-40774961 TGGTGGCACTGGAGAGGAGAGGG - Intronic
1183948296 22:41339032-41339054 TCGTGGGCGTGGAGGGGAGAAGG - Exonic
1183976546 22:41515583-41515605 TGGTGGGGATGAACGGGAGACGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184509354 22:44924062-44924084 GGGAGGGAGGGGAGGGAAGAGGG + Intronic
1184509368 22:44924098-44924120 AGGAGGGAGGGGAGGGAAGAGGG + Intronic
1184614570 22:45629484-45629506 AGGAAGGAAGGGAGGGAAGAGGG - Intergenic
1184690568 22:46115490-46115512 TGGAGGGTAGGGAGGGAAGTGGG - Intergenic
1184889086 22:47368615-47368637 TGGCGGGCATGGAGGGAAAGGGG - Intergenic
1184919658 22:47596822-47596844 TCATGGGAGAGGAGGGAAGAGGG - Intergenic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1185119618 22:48958139-48958161 TGGTGGGAGTGGAGAGCAGTGGG - Intergenic
1185417333 22:50717412-50717434 AGGTGGGATTGTGGGGAAGAAGG + Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949243484 3:1898016-1898038 TAGTGAGAATGTAGGAAAGAGGG + Intergenic
949356198 3:3182794-3182816 TGGTGGGAAGTGTGGGAAGAGGG - Intergenic
949359997 3:3221570-3221592 TGATGGGGATGAAGGGGAGAAGG - Intergenic
949441695 3:4088211-4088233 TGGAAGGAATAGATGGAAGAAGG - Intronic
949605581 3:5649640-5649662 TGCTGGGAGTTGAGGGGAGAGGG + Intergenic
949627490 3:5883506-5883528 TAGGGTGATTGGAGGGAAGAGGG + Intergenic
949634449 3:5967585-5967607 AGGGAGGAAGGGAGGGAAGAAGG - Intergenic
949789740 3:7779939-7779961 TGGTGAGAATGGAAGGAAAAAGG - Intergenic
950105653 3:10386684-10386706 TGATGGGATGGGAGGGCAGAGGG + Intronic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950515473 3:13462122-13462144 TAGTCTGAATGGAGGGAACAAGG + Intergenic
950670131 3:14521019-14521041 TGGTGGCTAAGGAGGGGAGAAGG - Intronic
950673743 3:14542024-14542046 TGGAGGGAATGGAGGCGAGTGGG - Exonic
950914013 3:16625257-16625279 TGGTGAGAATGTAGAGAAAAGGG + Intronic
951094180 3:18609136-18609158 AGGTGGGAATGGAGGCTACAAGG + Intergenic
951607275 3:24449980-24450002 AGGAAGGAAAGGAGGGAAGAAGG + Intronic
951630699 3:24716727-24716749 AGGTGGGATTGGGGGGAGGAAGG + Intergenic
951708263 3:25565812-25565834 TGGTGGGCTTGGTGGGAAGGAGG - Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952397559 3:32934394-32934416 TGGGGGGAATGGGGGGAAAGAGG + Intergenic
952459567 3:33510207-33510229 TGGGGGGGATGAAGGGAGGAAGG + Intronic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953447100 3:42977979-42978001 GGTTGGGAAATGAGGGAAGAGGG - Intronic
953557508 3:43958459-43958481 ACGTGGGAAGGGTGGGAAGACGG - Intergenic
953639008 3:44688228-44688250 GGGTGGTAATGGGGGGAATAGGG - Intergenic
953668763 3:44945105-44945127 TGGCGGGGATGGAGGGAGGCAGG + Intronic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
955163498 3:56488066-56488088 TAGTGGGAATTGAGGCAGGAGGG - Intergenic
955641196 3:61086938-61086960 TGGTGGGAGAGGAGTGAACAAGG - Intronic
955945219 3:64187394-64187416 AGTTGGGAAGGGAGGGAAGAAGG - Intronic
955977245 3:64490494-64490516 TGGGGGGAAGAGAGAGAAGAAGG + Intergenic
956524431 3:70142039-70142061 TGGTGTGAATGCAGTGAATAGGG + Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958439802 3:94142428-94142450 TGGTGAGAAAGGAAGTAAGAGGG + Intergenic
958696852 3:97538783-97538805 TCATGGGAATGGAGGCCAGATGG + Intronic
959136900 3:102434565-102434587 TGATGGGAATGGGGAGGAGAAGG - Intronic
959168184 3:102807194-102807216 TGGTGGGAGGGGCGGGGAGAGGG + Intergenic
959304851 3:104649291-104649313 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
959371199 3:105528208-105528230 AGGTGAGAATGTAGTGAAGACGG - Intronic
960345980 3:116533638-116533660 TGGGGAGAAGGGAGGGGAGAGGG + Intronic
960452069 3:117822305-117822327 TGGGGGAAAGGGAGGGAGGAAGG + Intergenic
960537036 3:118826034-118826056 TGGTGGAAATGGAGAGAAGGAGG + Intergenic
960616324 3:119599321-119599343 TGATGGAAGTGGAGGGAACAGGG + Intronic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961063045 3:123848978-123849000 TGGTAGGAATTGAGGGCAGATGG + Intronic
961148952 3:124619880-124619902 TGGTGAGAATGTAGAGAAAAGGG - Intronic
961276154 3:125728657-125728679 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961861431 3:129919395-129919417 GGGAGGGAAAGGAGGGAAGGAGG + Intergenic
961875335 3:130018383-130018405 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
962342713 3:134598620-134598642 TCGTGGGAAAGGAGAGAAGGTGG + Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962611163 3:137077465-137077487 TGGAGGGAATGGAGAGAAATGGG - Intergenic
962643057 3:137408204-137408226 TGGTAGAAATGGAGGGAAAAAGG + Intergenic
962752055 3:138440779-138440801 TGTTGGGCTTGGAGGAAAGAGGG - Intronic
963379544 3:144510090-144510112 TGGTGAGATTGTAGGGAAAAGGG - Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963672534 3:148270029-148270051 TGCTGGGAATGGATCCAAGATGG + Intergenic
963730378 3:148965628-148965650 TGGTGGCAAAGGAAGGAAGGTGG + Intergenic
963851124 3:150211368-150211390 AGGTGGGCAGGCAGGGAAGAAGG + Intergenic
963926172 3:150953428-150953450 TGGTGATAATGGAGAGAAAAGGG - Intronic
963929827 3:150991965-150991987 TGGTTGGGAAGGAGGGTAGATGG + Intergenic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964736066 3:159919204-159919226 TGGTGAGAATGCAGAGAAGTGGG + Intergenic
964743473 3:159990091-159990113 TGGCCAGAATGGAGGGAAGGTGG + Intronic
965179537 3:165384191-165384213 TGGTGGGAGTGGTGGGAGGTTGG + Intergenic
965202517 3:165677497-165677519 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
965211594 3:165797156-165797178 AGGAAGGAAGGGAGGGAAGAAGG - Intronic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
965667590 3:171111518-171111540 TGGTGAGGATGCAGAGAAGAGGG + Intronic
965952086 3:174321904-174321926 TGGTGAGAATGTAGAGAAAAGGG + Intergenic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966273830 3:178141389-178141411 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
966273888 3:178141557-178141579 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
966462816 3:180196488-180196510 TAATGGCAATGGTGGGAAGAGGG - Intergenic
966936485 3:184712959-184712981 AGGAGGGAAGGGAGGGAGGAAGG - Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967338207 3:188368014-188368036 TGTGGGGAAGGGAGGGCAGATGG - Intronic
967446878 3:189577654-189577676 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
967882657 3:194312959-194312981 TGGTGGGAAGGGAAGGAGGGAGG - Intergenic
967899988 3:194440074-194440096 AGGTGGGGAGGCAGGGAAGAGGG + Intronic
967931428 3:194693216-194693238 TGGTTTGAATGGTGAGAAGATGG + Intergenic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968050686 3:195653011-195653033 TGGGGAGAATGGAGAGAAGCAGG - Intergenic
968105135 3:195995338-195995360 TGGGGAGAATGGAGAGAAGCAGG + Intergenic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968303430 3:197632920-197632942 TGGGGAGAATGGAGAGAAGCAGG + Intergenic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
968725200 4:2244133-2244155 GGGTGGGAATGCAGGGCTGAGGG + Intergenic
968937048 4:3617069-3617091 GGGAGGGACAGGAGGGAAGAAGG - Intergenic
968937149 4:3617367-3617389 TGGAAGGACAGGAGGGAAGAAGG - Intergenic
968937188 4:3617477-3617499 GGGAGGGATGGGAGGGAAGAAGG - Intergenic
968937225 4:3617573-3617595 AGGAGGGAGGGGAGGGAAGAAGG - Intergenic
969036938 4:4262027-4262049 GGGTGGGGATGGAGGGCACAAGG - Intergenic
969207670 4:5659491-5659513 TGTTGGGACGGGAGGGAGGATGG + Intronic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
969465848 4:7355947-7355969 TGGAAGGAAGGGAGGGCAGAGGG - Intronic
969481587 4:7449339-7449361 AGGAAGGAAAGGAGGGAAGAAGG - Intronic
969706368 4:8794324-8794346 GGGTGGGAATGGAGGGACAGAGG + Intergenic
969735349 4:8985569-8985591 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
969786654 4:9463400-9463422 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
970056763 4:11982608-11982630 TGGAGGGAAGGAAGGAAAGAAGG + Intergenic
970159349 4:13173329-13173351 GGGAGGAAACGGAGGGAAGAAGG + Intergenic
970444520 4:16112703-16112725 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444529 4:16112724-16112746 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444538 4:16112745-16112767 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970638948 4:18041823-18041845 TGGTGGGAATGGAGTAGAGTAGG + Intergenic
970705958 4:18802817-18802839 TGCTCTGAATGGAGGAAAGATGG + Intergenic
970773398 4:19642545-19642567 TGGTAAGGATGGAGGGAAAAGGG - Intergenic
970923359 4:21421143-21421165 TGGTGAGGATGTAGAGAAGAGGG + Intronic
971021765 4:22544208-22544230 TGGTGGGAGTGGAGAGGAAATGG + Intergenic
971045543 4:22801615-22801637 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
971618152 4:28820342-28820364 AGGAAGGAATGGAGGAAAGAAGG + Intergenic
971962093 4:33502259-33502281 TGGTGGGGATGCAGTGAAAAGGG - Intergenic
971989469 4:33872714-33872736 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
972055523 4:34797185-34797207 AGGGAGGGATGGAGGGAAGAAGG - Intergenic
972404441 4:38733185-38733207 TGGTGGTAATGGTGGGATGGTGG + Intergenic
972415668 4:38838102-38838124 TGGTGAGAATGCAGAGAAAAGGG + Intronic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
972771854 4:42204731-42204753 TGGCAGGCATGGGGGGAAGAGGG - Intergenic
973173477 4:47174855-47174877 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
973554059 4:52064422-52064444 TGGAGGGAAAGGAAGGAGGAGGG - Intronic
973869592 4:55152284-55152306 TGGTGGGATGGGAGGGAAGAGGG - Intergenic
973877939 4:55240509-55240531 TTTTGGGAATGGTGTGAAGAAGG - Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974642147 4:64645060-64645082 GGGTGGAAATAAAGGGAAGATGG - Intergenic
975226250 4:71876262-71876284 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
976002461 4:80388092-80388114 TGGTGGGAATGGTGTGGTGAAGG - Intronic
976217915 4:82732018-82732040 TGGAGGTAATGGAGGAAAGTGGG - Intronic
976326634 4:83779247-83779269 TGGGGGGAAGGGAGGGGAAATGG - Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
976616789 4:87086413-87086435 GGGTGGGAAGGGAAGGAGGACGG - Intronic
976713995 4:88103708-88103730 TGTGGGGAATGGAGAGATGATGG - Intronic
976729170 4:88244988-88245010 TGGTGCCCATGGAGGGCAGAAGG - Intergenic
976744803 4:88392068-88392090 AGGGGGGAGTGGAGGGGAGAAGG - Intronic
976876015 4:89854631-89854653 TGGTGAGAAAGGAAGCAAGAGGG + Intergenic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
977180545 4:93868062-93868084 TGGCAGGAATTGAGGGGAGATGG - Intergenic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
978174461 4:105712405-105712427 TGGCTGGAAGGGAGTGAAGAAGG + Intronic
978197695 4:105990356-105990378 TGGTGGGAATCCAGGGAAAGGGG - Intronic
978243804 4:106548836-106548858 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
978925714 4:114240580-114240602 TGGTCGGGATGCAGAGAAGAGGG - Intergenic
979701573 4:123674091-123674113 TGGTGTGAGTGGAGGGGAGGAGG - Intergenic
979980576 4:127249505-127249527 TGGTAGCCATGGAGGGAAGGGGG + Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980722525 4:136716914-136716936 TGCAGGGAAGGGAGGGCAGAGGG - Intergenic
980741714 4:136958405-136958427 TGATGGGAAAGCAGGGAATAAGG - Intergenic
980991971 4:139745858-139745880 TCCTGGGGATGGAGGAAAGATGG + Intronic
981026754 4:140084578-140084600 TGGTGGGAAAGGAGGTAATGGGG - Intronic
981342496 4:143637906-143637928 TGGTGGGTGGGGAGAGAAGAAGG + Intronic
981616122 4:146646804-146646826 TGGTGGGAGTGGAGGGAGAGAGG - Intergenic
982297423 4:153844070-153844092 TGGGTGGCATGGAAGGAAGAGGG + Intergenic
982358877 4:154497317-154497339 TGGAGGGAATGGGGAGAAGTTGG - Intergenic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982520156 4:156406543-156406565 TGGCAGGGATGGAGGGAAAAGGG + Intergenic
983005596 4:162480846-162480868 TGGTGAGAATGTGGAGAAGAAGG + Intergenic
983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG + Exonic
983387424 4:167082830-167082852 GGGAGGGAAGGAAGGGAAGAGGG + Intronic
983534156 4:168839564-168839586 TGGTGGGATGGGAGGGGTGAGGG + Intronic
983666873 4:170192784-170192806 AGCTGGGAATGGAGGGACGATGG + Intergenic
983807579 4:172014354-172014376 TGGTGAGAATGTAGAGAAAAGGG - Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984148570 4:176095684-176095706 TGGTAGGAAGCGAGGAAAGAAGG - Intronic
984159127 4:176229916-176229938 GGGTGGGAGTGGAGAGCAGAAGG + Intronic
984256965 4:177400869-177400891 GGGAGGGACTGAAGGGAAGATGG - Intergenic
984460854 4:180034702-180034724 TGGAAGGAAGGGAGGGAGGAAGG + Intergenic
984675555 4:182543236-182543258 TGGAGGGAAGGGAGGGAGGAAGG + Intronic
984822052 4:183890547-183890569 AGGGAGGAATGGAGGGAGGAAGG + Intronic
985069408 4:186153182-186153204 TGATAGAAATGGAGGGAAGGTGG + Intronic
985230041 4:187805818-187805840 TAGTGAGAATGCAGAGAAGAGGG + Intergenic
985338539 4:188922213-188922235 TGGTGGGAATTGAGGCAAGGAGG - Intergenic
985507479 5:292033-292055 TGGGGAGAATGGAGAGAAGCAGG - Intronic
985740494 5:1613099-1613121 TGGGGAGAATGGAGAGAAGCAGG + Intergenic
985958055 5:3279026-3279048 AGGGAGGAAGGGAGGGAAGAGGG - Intergenic
986009049 5:3695443-3695465 TGGGGGAGGTGGAGGGAAGAAGG - Intergenic
986445401 5:7816513-7816535 GGAGGGGAAAGGAGGGAAGAAGG + Intronic
986527879 5:8700374-8700396 TGGTGGCAAAGGTCGGAAGACGG + Intergenic
986585517 5:9312968-9312990 TGGTGGGAGAGGAGTGGAGAGGG + Intronic
986587762 5:9336287-9336309 AAGTGGGAATGCAGGGCAGAAGG + Intronic
987258722 5:16182332-16182354 TGGTGGGGATGGAGGTGAAAAGG - Intergenic
987291723 5:16514678-16514700 TGGGGGGAATGGTGGGAGGGAGG - Intronic
987373909 5:17217452-17217474 TGGAGGGGGTGGAGGGGAGACGG + Intronic
987642565 5:20631540-20631562 AGATAGGAAGGGAGGGAAGAAGG + Intergenic
987696999 5:21344771-21344793 TGGAAGGAAGGGAGGGAGGAAGG - Intergenic
987961357 5:24813559-24813581 GGGTGGTAATGGTGGGAATAAGG + Intergenic
989069622 5:37497166-37497188 AGGGGGGAAGGGAGGGAAGGAGG - Intronic
989136493 5:38161177-38161199 AGGTGGAAAGGGAGGGAAGGAGG + Intergenic
989146129 5:38251844-38251866 TGGTGGGACAGGAAGAAAGATGG - Intergenic
989427405 5:41312647-41312669 AGGGAGGAAGGGAGGGAAGAAGG - Exonic
989550760 5:42733649-42733671 TGGCGGGAAGGGAAGGAAGCAGG + Intergenic
989732170 5:44662247-44662269 TGGGAAGAATGAAGGGAAGAAGG - Intergenic
989788231 5:45357958-45357980 TGGTGAGAAAGGAAGCAAGAGGG - Intronic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
990512509 5:56501433-56501455 TGGTGTGATTGGAGGGAATCTGG - Intergenic
990700325 5:58467956-58467978 AGTTGGGTATGGAAGGAAGAGGG - Intergenic
991443714 5:66678265-66678287 TGGGGGGAATGGGGAGAAGTTGG + Intronic
991518921 5:67472480-67472502 TGGAAGGAAGGGAGGGAAGGAGG - Intergenic
992007303 5:72490578-72490600 TGCTGGGCATGGAGGGACAATGG + Intronic
992590088 5:78285847-78285869 TGGTGGTAGTGGAGAGAAGTGGG - Intronic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
992887267 5:81170951-81170973 TGGTAGGAAGGGTGGGAGGAAGG - Intronic
993012655 5:82501073-82501095 GGGAAGGAAGGGAGGGAAGAAGG - Intergenic
993481188 5:88426324-88426346 TGGGGAGAAGGGAGGGAGGAAGG + Intergenic
994079249 5:95687924-95687946 TGGTGAGAATGCAGAGAAAATGG + Intronic
994736077 5:103558168-103558190 TAGTAGAAATGGAGGAAAGAGGG - Intronic
994842311 5:104941220-104941242 AGGAAGGAAGGGAGGGAAGAAGG + Intergenic
995154812 5:108898515-108898537 GGGAGGGAAAGGAAGGAAGAAGG - Intronic
995522885 5:113027485-113027507 AGGTGGGAATGAAGGGAAATTGG + Intronic
996089327 5:119335623-119335645 TGGCTGGAAGGGAGGGCAGAAGG - Intronic
996167418 5:120242311-120242333 AGGAAGGAAAGGAGGGAAGATGG - Intergenic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996339006 5:122415568-122415590 AGTTGGAAATGGAGAGAAGAGGG + Intronic
996369506 5:122738360-122738382 TGGAGGGCATGGAGCCAAGAAGG - Intergenic
996698638 5:126425862-126425884 GGGTGGGGAAGGAGGGAATAGGG + Intronic
997506602 5:134422766-134422788 TGGGGGGAAGGGAGAGGAGAAGG - Intergenic
997574457 5:134963314-134963336 TGGTGTGCAGGGAGAGAAGAGGG + Intronic
997590066 5:135066986-135067008 TGGTGGGAATGGAGGAAGCCAGG + Intronic
997600578 5:135135761-135135783 TGCTGTCAGTGGAGGGAAGATGG - Intronic
997689739 5:135819585-135819607 GGATGGGAATGGAGGGAAAATGG + Intergenic
997882240 5:137601480-137601502 TGAAGGGAGTGGAGGGATGAAGG + Intergenic
997896689 5:137725044-137725066 TGGAATGAATGGAGGGAAAAAGG - Intronic
998025943 5:138816510-138816532 TGGTGGGAATGCAGGGAAAGGGG - Intronic
998039587 5:138943950-138943972 TGGTAGGACAGGAGGGGAGAGGG - Intergenic
998155609 5:139785213-139785235 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
998465611 5:142341504-142341526 GGGTAAGAATGGAGGAAAGAGGG + Intergenic
998471865 5:142389874-142389896 TGTGGGGAATGCAGGGAAGCAGG + Intergenic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
998638919 5:143987484-143987506 AGGAGGGAATGGAGGGAATGAGG - Intergenic
998844942 5:146299431-146299453 TGGTGTGGATGTAGGGAAAAGGG - Intronic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999546440 5:152634051-152634073 TGTAGGGAACGGAGGGCAGAGGG - Intergenic
999616820 5:153433595-153433617 TGGTGGGAATAGACTGTAGAGGG - Intergenic
999751671 5:154632235-154632257 TGGAGGGAAGGGAGGGAGGGAGG - Intergenic
999758529 5:154682887-154682909 CGGGTGGAATGGAGGGAGGAGGG - Intergenic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000346958 5:160322258-160322280 GGTTGGGAAAAGAGGGAAGAGGG - Intronic
1000429708 5:161136580-161136602 TGCTGGGAAAGGAAGGAAAAAGG - Intergenic
1000441632 5:161270737-161270759 TGGTGGGCATGGAGAGAGGGGGG + Intergenic
1000833981 5:166133470-166133492 TGGTGGTATTGGAGGGAATAAGG + Intergenic
1000946432 5:167427831-167427853 GGGAGGGAAGGAAGGGAAGAAGG + Intronic
1000984930 5:167855956-167855978 AGGAGGGAAGGGAGGGAAGAAGG + Intronic
1001144329 5:169170553-169170575 TGATGGGAATGGAAGCAAGCTGG + Intronic
1001200997 5:169716669-169716691 TGGAGGAAATGGGGAGAAGAAGG - Intronic
1001635171 5:173204885-173204907 TGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1001684344 5:173582271-173582293 TGGTGAGAAAGGAAGGGAGAAGG + Intergenic
1001744800 5:174084120-174084142 TGGAGGAAATGGAAGGAAAAAGG - Intronic
1001824321 5:174733274-174733296 TGCGGGGAATGGAGGGAGCAGGG + Intergenic
1001894244 5:175364743-175364765 TGGTTGCCAGGGAGGGAAGAGGG - Intergenic
1002102360 5:176863791-176863813 AGGAGGGGAAGGAGGGAAGAAGG - Intronic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002188615 5:177467661-177467683 GGGTGGGGATGGCGGGAGGATGG - Intronic
1002190749 5:177476201-177476223 AGGTGGGGGTGGAGGGAGGAGGG - Intergenic
1002209235 5:177586344-177586366 TGGTGTGGATGGAGTGAACAGGG - Intergenic
1003173217 6:3736366-3736388 TGGTGGACAGGGAGGGAAGGGGG - Intronic
1003226077 6:4207148-4207170 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1003878826 6:10462131-10462153 GGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1004239596 6:13907996-13908018 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1004351359 6:14893071-14893093 GGTTGGGGATGGAGGGAAGGAGG + Intergenic
1004695293 6:18027540-18027562 GGGGGGAAATGGAGGCAAGATGG - Intergenic
1004748661 6:18538556-18538578 GGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1005157783 6:22826978-22827000 TGTTGGGAATGTAGGGTTGAAGG - Intergenic
1005283873 6:24303390-24303412 TTTTGGGAATGGAGGGGAGCAGG - Intronic
1005301592 6:24476376-24476398 TGAGGGGCATGGAGGGAAGGAGG - Intronic
1005516162 6:26556345-26556367 TGGTGAGAATGGGGAAAAGAGGG + Intergenic
1005680376 6:28201038-28201060 TGGTGAGAATGTAGGGAAATTGG - Intergenic
1005800932 6:29423633-29423655 TGGTGAGAATGCAGAGAAAAGGG - Intronic
1005877913 6:30028127-30028149 TCGGGGAAAGGGAGGGAAGAAGG + Intergenic
1006382037 6:33704607-33704629 TGGTGGGGATGGTGGCAGGACGG - Intronic
1006412852 6:33885388-33885410 TGGTGGAGTAGGAGGGAAGAGGG - Intergenic
1007004403 6:38346865-38346887 TGGAGGGAATAGAGGGAATGTGG + Intronic
1007019735 6:38507487-38507509 TGGATGGTATGGAGAGAAGAGGG - Intronic
1007259544 6:40554068-40554090 TGGTGGCAATGGAGGGTCGTAGG - Intronic
1007277878 6:40689046-40689068 GGATGGGAATGGTGGGGAGATGG - Intergenic
1007350106 6:41266278-41266300 TGGTGAGAGTGGAGGAAAGGGGG + Intergenic
1007770245 6:44186321-44186343 TGGTGATAATGGAGGGAAGGCGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1008497209 6:52145475-52145497 AGGAGGAAAGGGAGGGAAGAAGG + Intergenic
1008541375 6:52549242-52549264 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
1008713179 6:54254768-54254790 GGGGGGGAAGGGAGGGAGGAAGG - Intronic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1008911973 6:56744191-56744213 TGGTGGGAATCCACAGAAGATGG + Intronic
1009243110 6:61203266-61203288 AGGAGGGAAGGGAGGGAAGGAGG + Intergenic
1009435452 6:63613083-63613105 TGGTGGGAATGGAGAGATAAGGG + Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009653785 6:66512709-66512731 TGGTGAGAATGTATAGAAGAGGG + Intergenic
1010009126 6:71029430-71029452 TGGGGGCAAAGGAGGGAAAATGG - Intergenic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010177840 6:73050301-73050323 AGGAAGGAAGGGAGGGAAGAAGG + Intronic
1011382973 6:86762493-86762515 AGGTGGGCAAGGAGGAAAGAGGG - Intergenic
1011389746 6:86838651-86838673 TGGGGGGAAAGGAGGAAAGGGGG + Intergenic
1011524736 6:88252281-88252303 TTGGGTGAATGGATGGAAGAAGG + Intergenic
1011632321 6:89339516-89339538 AGGGGGGAAGGGAGGGAAGTGGG + Intronic
1011788555 6:90873039-90873061 TGCTGGGAATTCAGCGAAGAAGG - Intergenic
1012069661 6:94597599-94597621 TGAGGGGCATGGAGGGAAAAGGG - Intergenic
1013045298 6:106479563-106479585 TGGTGAGGATGTAGGGAAAAAGG - Intergenic
1013251298 6:108336277-108336299 TGGGGGGAATGGAGAGAAACAGG + Intronic
1013717017 6:112974660-112974682 TGGTGAGAATGTGGAGAAGAGGG - Intergenic
1013734116 6:113205868-113205890 TGGAAGGAAGGAAGGGAAGAAGG - Intergenic
1013971605 6:116026525-116026547 AGGGGGGAAGGGAGGAAAGAAGG + Intronic
1014005235 6:116410288-116410310 TTGTGGGAAGGGAGGGAACTGGG - Intronic
1014478623 6:121906979-121907001 TGGTGGGATTGTAGAGAAGAGGG - Intergenic
1014677013 6:124379207-124379229 GGGAGGGAAAGGAGGGAAGAGGG + Intronic
1014951589 6:127562161-127562183 TGGTGGGAAGGGAGGGAATAGGG + Intronic
1015014254 6:128391288-128391310 TGGTGGTAATGGGGAGAGGAAGG - Intronic
1015211943 6:130708611-130708633 TGGTGAGAGAGGAAGGAAGAAGG + Intergenic
1015743243 6:136481629-136481651 TGGTGGGGATGGAGGGAGTAGGG + Intronic
1015823208 6:137284445-137284467 GGCTGGGAAAGGAGGGAAGATGG + Intergenic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1017358784 6:153541994-153542016 AGGTGGGAATGGAGGTGAGCAGG - Intergenic
1017403503 6:154091564-154091586 GGATGAGAATGGAGGGAAGAGGG + Intronic
1017557804 6:155591274-155591296 AGGTGGGAATGAAGAGAAGTTGG - Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017648038 6:156556864-156556886 TGGTGGGATTGGAGGGACCTGGG - Intergenic
1017661239 6:156675971-156675993 TGGGAGGAATGAAGGGAAGTTGG + Intergenic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1018781317 6:167068694-167068716 TGGTGGGAATGTGGTGAAAAGGG - Intergenic
1019002118 6:168763146-168763168 TGGCGAGAATGGAGGCAAGAGGG + Intergenic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019103571 6:169650737-169650759 TGGTGGGGATGGAGGGATGGAGG - Intronic
1019264595 7:106792-106814 TGGAGGGAATGAAGAGAAGGTGG + Intergenic
1019271201 7:150078-150100 TGGTGGCGGTGGAGGGGAGATGG + Intergenic
1019335707 7:481593-481615 GGGCGGGAAGGGAGGGAGGAGGG - Intergenic
1019502618 7:1372230-1372252 TGGTGGGAGGGCAGGGAGGAAGG + Intergenic
1019697284 7:2452662-2452684 GGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1019713886 7:2529673-2529695 TGATGGGGATGGCGGGAGGATGG + Intergenic
1020129040 7:5549139-5549161 GGGAGGGAAGGAAGGGAAGAAGG + Intronic
1020154429 7:5710724-5710746 GGGTGGGAGTGGAGTGGAGATGG - Intronic
1020310437 7:6863496-6863518 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1020356305 7:7279450-7279472 TGGTGGGAATGGAGTGGAGGAGG + Intergenic
1020459562 7:8413195-8413217 TATTGAGAATGGACGGAAGAAGG + Intergenic
1020702803 7:11504308-11504330 TGATGGGAAGGGTGGGAGGAAGG + Intronic
1020876141 7:13696868-13696890 TGGTGGGAATGGAGAGAAACAGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021127755 7:16872959-16872981 TGGTGAGGATGCAGAGAAGAGGG + Intronic
1021209754 7:17834043-17834065 TGATGGGGATGGAGGTAAGGTGG - Exonic
1021296832 7:18918333-18918355 TGGGGGGGATGGAGGGGAAAGGG + Intronic
1021360023 7:19701369-19701391 TACAGGGAACGGAGGGAAGAAGG + Intronic
1021367422 7:19797038-19797060 TGGTGGGCATGTAGAGAAAAGGG - Intergenic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021472737 7:21024326-21024348 AGGTGGGGAAGGAGGGAATAGGG - Intergenic
1021579251 7:22135095-22135117 TGGTGGCAATGGGAGGAAGTGGG + Intronic
1021655734 7:22871932-22871954 TAGTGGGAATAAAGGGAAGGGGG - Intergenic
1022109245 7:27218209-27218231 TGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1022130949 7:27403911-27403933 TGGTGGGGTGGGAGGGAAGGTGG + Intergenic
1022384549 7:29889097-29889119 TGGTTGGGATGGAGGGAAGCAGG - Intronic
1022522139 7:31015257-31015279 TGGTAGGAATAGTGAGAAGAAGG - Intergenic
1022804757 7:33810512-33810534 TGGTAGGAAGGGAGGGAATGTGG - Intergenic
1023062661 7:36343413-36343435 TGGGGGGAGAGGAGGGGAGATGG + Intronic
1023505874 7:40899228-40899250 TGGTGAGGAGGGAGGGAAGGAGG - Intergenic
1023569966 7:41561624-41561646 TGGTGGGAAGAGAGAGAGGAAGG + Intergenic
1023770661 7:43553840-43553862 TTGTGCAAGTGGAGGGAAGAAGG - Intronic
1024224475 7:47315168-47315190 TTGTGGGAATTAAGGGCAGAAGG - Intronic
1025240394 7:57266916-57266938 TGGTGTGAAAGGTGGCAAGAGGG + Intergenic
1025299349 7:57805739-57805761 AGGAGGGAATGCAGGGAGGAAGG - Intergenic
1026046589 7:66909795-66909817 TGGTGGGAATTGGGGAAAGGAGG - Intergenic
1026605920 7:71815778-71815800 GGGTGGGAAGGGAGGAAAGGGGG - Intronic
1026806280 7:73431122-73431144 TGGTGGCAATGGTGAGAAAATGG - Intergenic
1026852681 7:73734993-73735015 TGCTGGGAAGGGAGGGCAAAGGG + Intergenic
1026928439 7:74209893-74209915 TGGGGGGAAGGGAGGGGAGACGG - Exonic
1026930001 7:74218504-74218526 TGCTGGGAATGCAGAGATGAGGG - Intronic
1027260238 7:76459811-76459833 TGGAGGGAAGGGAGTGAGGAAGG - Intergenic
1027261507 7:76468057-76468079 CGGGGGGAATGGAGAGAGGAGGG + Intronic
1027311613 7:76957919-76957941 TGGAGGGAAGGGAGTGAGGAAGG - Intergenic
1027504894 7:79003959-79003981 TGGTGAGGATGCAGGGAAAAGGG + Intronic
1027990720 7:85357329-85357351 TGGTATAAATTGAGGGAAGAGGG + Intergenic
1028120086 7:87047679-87047701 TGGTGAGAATGTAGAGAAAAGGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028531264 7:91841275-91841297 TGCTGGGGATGGAGGGAGGTGGG - Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028913844 7:96237289-96237311 TGGTGACAATGGAGAGAGGAGGG + Intronic
1028921576 7:96315705-96315727 TGCTAGGAATGGAGGAAAGAAGG - Intronic
1029040142 7:97564818-97564840 TGATGGGAATAAAGAGAAGATGG + Intergenic
1029077140 7:97943825-97943847 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1029200039 7:98833321-98833343 TGGGGAGGATGGAGGGAGGAGGG + Intergenic
1029469688 7:100746486-100746508 TGGATGGAATTGAGGGAAGATGG - Intronic
1029628861 7:101737789-101737811 AGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1029850227 7:103453959-103453981 TGGTGGGGGTGGAGCCAAGACGG - Intergenic
1029899343 7:104022668-104022690 TGCTGGGAATGCAGAGATGACGG + Intergenic
1030241961 7:107337156-107337178 TGGTGAGGATGCAGGGAAAAAGG + Intronic
1030289923 7:107861897-107861919 TGGTGAGGAGGGAAGGAAGAAGG + Intergenic
1030334396 7:108308766-108308788 TGGTGGGAGTGGTGAGAAGGGGG + Intronic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032453095 7:132051592-132051614 TGGTGGGAATGAAGGGAAATAGG - Intergenic
1032494495 7:132350685-132350707 TGGTGGGAATGGAAGTGAGGTGG + Intronic
1032505736 7:132433345-132433367 TGCTGGGTATGTAGGGTAGAAGG - Intronic
1032777895 7:135134075-135134097 GGATGGGAAAGGAGGGAAGCAGG + Intronic
1032822684 7:135539110-135539132 TGGGAGGAATGGAGGGAGGGAGG - Intergenic
1032849588 7:135782658-135782680 GGATGGGAAAGGAGGGAAGTGGG - Intergenic
1033122594 7:138679084-138679106 TGGAAGCAAGGGAGGGAAGAAGG + Intronic
1033263690 7:139865919-139865941 GGGAGGGAAGGAAGGGAAGAAGG + Intronic
1033396226 7:140976396-140976418 GGGTGGGAATGGAGGAGACAGGG - Intergenic
1033414034 7:141146791-141146813 GGGTGGGAAAGGATGGTAGAAGG - Intronic
1033457058 7:141512095-141512117 TGGAGGGAAAGGAGGGAAAGCGG - Intergenic
1033599694 7:142880196-142880218 TGGTGGTGATGGAGGGAATGTGG - Intronic
1033966934 7:146986637-146986659 TGGCGTGGATGGAGTGAAGAGGG - Intronic
1034065882 7:148136095-148136117 TGGAGGGAACGGAGGGAGGAAGG + Intronic
1034442686 7:151094821-151094843 AGGAGGGAAGGGAGGGAGGAAGG - Intronic
1034870948 7:154683481-154683503 TGGTGGGAACAGAAAGAAGAAGG - Intronic
1034902112 7:154914266-154914288 TGGTGGGAATGCGGGGAGCACGG - Intergenic
1035399894 7:158557870-158557892 TGCTGGGAATGCTGGGAAGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035899905 8:3448298-3448320 TGGTGGGAAGGAAGGAAGGAAGG + Intronic
1035930672 8:3776643-3776665 TGGTGGGAAGGAGGGAAAGAAGG - Intronic
1036240645 8:7078121-7078143 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036261410 8:7243457-7243479 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1036305189 8:7596099-7596121 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036313450 8:7702001-7702023 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1036356039 8:8044095-8044117 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036505376 8:9350022-9350044 GGGTGGGAGAGGAGAGAAGAGGG + Intergenic
1037305544 8:17499394-17499416 GAGAGAGAATGGAGGGAAGAGGG - Intronic
1037405721 8:18540680-18540702 TGGAGGGCAAGGAGGGAACAGGG - Intronic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037926847 8:22850359-22850381 TGGTGGGAAGGGACTGAAGAGGG + Intronic
1038040327 8:23718666-23718688 TGGAGTGAATGAGGGGAAGAGGG + Intergenic
1038307749 8:26420052-26420074 TGGTGGGCGTGGAGGGCAGGAGG - Intronic
1038452801 8:27650730-27650752 TTGTTGGCATGGAGGAAAGAGGG - Intronic
1038750758 8:30293554-30293576 TGGTGGGGATGCAGTGAAAAGGG + Intergenic
1039612055 8:38927933-38927955 TGGTGGGAATGGAGAGTGGGGGG + Intronic
1039954671 8:42197738-42197760 TGGTTTTTATGGAGGGAAGATGG - Intronic
1040015495 8:42696028-42696050 TTGTGGGAATGCAAGGAGGAAGG - Intergenic
1041039569 8:53833760-53833782 TGATTGGGAGGGAGGGAAGATGG - Intronic
1041128520 8:54669874-54669896 TGGTGGGGTGGGAGGGAAGGGGG + Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1041387136 8:57316536-57316558 TGGTGAGAATGTAGAGAAAAGGG + Intergenic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042082320 8:65068735-65068757 AGATAGGAATGAAGGGAAGAAGG - Intergenic
1042128054 8:65558781-65558803 TGGTGGGAGTGGATTGCAGAAGG - Intergenic
1042210422 8:66375177-66375199 GGGTGGGAATTGAGGAAGGAGGG - Intergenic
1042273349 8:66978039-66978061 TGGTGAGAATGCAGAGAAAAGGG - Intronic
1042487984 8:69367513-69367535 TGGTGGGAAGGGAGGAAAGTAGG - Intergenic
1042528489 8:69791029-69791051 AGGGAGGAATGGAGGGAGGAGGG + Intronic
1042705935 8:71665633-71665655 AGGGAGGAATGGAGGGTAGAAGG - Intergenic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043148917 8:76688386-76688408 GGCTGGGAAGGGAGAGAAGAGGG + Intronic
1043199717 8:77351376-77351398 TAGTTGGAATGGAGATAAGATGG - Intergenic
1043514874 8:80986676-80986698 TGGAGGGTATGGAGGGATTAGGG + Intronic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1044119955 8:88382484-88382506 AGGGAGGAAGGGAGGGAAGAGGG - Intergenic
1044119962 8:88382503-88382525 GGAGGGAAATGGAGGGAAGAGGG - Intergenic
1044308565 8:90666168-90666190 TGCTGGGCATGGAGCGGAGACGG + Intronic
1044462053 8:92457191-92457213 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045251345 8:100485612-100485634 TGGTAGGAATGGAGGTGAGGAGG + Intergenic
1045523207 8:102921408-102921430 GGGAGGGAAGGGAGGGAGGAAGG - Intronic
1046089737 8:109487451-109487473 TGGAAGGAAGGGAGGGAGGAAGG - Intronic
1046140932 8:110090617-110090639 TGGTGGGAGTTTAGGAAAGATGG - Intergenic
1046795310 8:118365154-118365176 TGGTCAGAAGGGAGGGAAGATGG - Intronic
1047237486 8:123054836-123054858 TGGGGGGAAGGGTGGGAAGGGGG + Intronic
1047402207 8:124556828-124556850 TCCTGGGAATGGAGGGAGAAGGG - Intronic
1047618724 8:126585093-126585115 TGGAAGGAGAGGAGGGAAGACGG - Intergenic
1047741853 8:127812690-127812712 TGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1047987349 8:130248633-130248655 TGGTGGAAATGGAAGGTAAAGGG + Intronic
1048091441 8:131245174-131245196 TGGTGGCAATGGGGTGCAGAAGG - Intergenic
1048226363 8:132590198-132590220 GGGAGGCAATGGAGGGAAGCTGG + Intronic
1048263101 8:132962103-132962125 TGGTGGTGATGAAGTGAAGAAGG + Intronic
1048363136 8:133715241-133715263 GGGAGGGAAAGGAGAGAAGACGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048609191 8:136003426-136003448 GGGTGGGAATGGTGTGAAAATGG + Intergenic
1048975964 8:139673195-139673217 TGGGGGGAATGGAGGGCCGGGGG + Intronic
1049014103 8:139907505-139907527 TGGGGGGAAGGGAGAGGAGAGGG + Intronic
1049221362 8:141430249-141430271 TGGTGGGGATGGTGGGGACAGGG + Intronic
1049221426 8:141430462-141430484 TGGTGGGGATGGTGGGGACAGGG + Intronic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049311771 8:141937360-141937382 AGGTGGGAGGGAAGGGAAGAGGG - Intergenic
1049393304 8:142382978-142383000 TGGGGGGAAAGGAGGGCAGGGGG + Intronic
1049421829 8:142520219-142520241 TGGTGGTGATGGAGTGATGATGG + Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1049939579 9:532528-532550 TGGAGGGAGTGGAGGGAAATGGG - Intronic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050146740 9:2576167-2576189 TGGTGCGAATGGTTGAAAGATGG + Intergenic
1050696613 9:8286273-8286295 TGTTGGGGAAGGAGGGAATAAGG - Intergenic
1050783141 9:9364645-9364667 TGGAGGCAATGGAGGGAGAAAGG + Intronic
1050973066 9:11901683-11901705 GGAAGGGAATGGATGGAAGAGGG - Intergenic
1051164573 9:14248207-14248229 TGGAAGGAAGGGAGGAAAGAAGG - Intronic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1051528903 9:18078002-18078024 GGGTGGGAAGGGATGGAGGAAGG + Intergenic
1051735113 9:20189924-20189946 TGCTGGGAGGGGAGGGGAGATGG + Intergenic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1051886692 9:21900523-21900545 TGGTGAGATTGCAGGGAAAATGG + Intronic
1052114409 9:24632286-24632308 TGGTGGGTATGTGGAGAAGAGGG - Intergenic
1052337766 9:27337399-27337421 TGTTTGGAATGGAGGCAGGAAGG - Intronic
1052383799 9:27801599-27801621 GGCTGGGACTGGAGGGAATAAGG - Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052475700 9:28956638-28956660 GGGAGGGAAAGAAGGGAAGAAGG - Intergenic
1052475716 9:28956690-28956712 AGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052566391 9:30158588-30158610 TGGAGGTAATGAAAGGAAGAGGG - Intergenic
1053123168 9:35560867-35560889 TGGTAGGGATGGAGGGAGTAGGG + Intronic
1053182106 9:35981576-35981598 TGGTAGGAAGAGAGGGAAGGAGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053551053 9:39079822-39079844 TGTTGGGAATGGGGGAAAGTTGG - Intronic
1053622939 9:39839302-39839324 TGGTGAGAATGCAGAGAAAAAGG + Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053815163 9:41899903-41899925 TGTTGGGAATGGGGGAAAGTTGG - Intronic
1053881934 9:42603925-42603947 TGGTGAGAATGCAGAGAAAAAGG - Intergenic
1053890734 9:42690363-42690385 TGGTGAGAATGCAGAGAAAAAGG + Intergenic
1054220958 9:62411391-62411413 TGGTGAGAATGCAGAGAAAAAGG - Intergenic
1054229756 9:62497781-62497803 TGGTGAGAATGCAGAGAAAAAGG + Intergenic
1054453920 9:65420099-65420121 AGGAGGGAGGGGAGGGAAGAAGG + Intergenic
1054453958 9:65420199-65420221 GGGAGGGATGGGAGGGAAGAAGG + Intergenic
1054454100 9:65420619-65420641 GGGAGGGACGGGAGGGAAGAAGG + Intergenic
1054615433 9:67287538-67287560 TGTTGGGAATGGGGGAAAGTTGG + Intergenic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1054871465 9:70050767-70050789 TGGTTGGAATGAAGAGTAGATGG - Intronic
1054902375 9:70382990-70383012 TGGTGAGGATGGAGGAAAGGGGG - Intergenic
1055480287 9:76702930-76702952 TGGGGGGAATGGAAGGAGTAGGG - Intronic
1055497116 9:76866862-76866884 TGGTCAGAAGGGAGGGAGGAGGG + Intronic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056201157 9:84278025-84278047 TGGTGGGGAGGGAGGGGAGGAGG + Exonic
1056204742 9:84309164-84309186 TGTTGGGTAGGGAGGGTAGATGG + Intronic
1056210984 9:84365154-84365176 TGGTGAGAATGAAGAGAAAAGGG - Intergenic
1056616290 9:88169208-88169230 AGGAAGGAAGGGAGGGAAGAAGG + Intergenic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056711754 9:88997372-88997394 TCCCGGGAATGGAGAGAAGAGGG - Exonic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057458132 9:95233117-95233139 AGGCGGGAAAGGAGGGGAGATGG + Intronic
1057565084 9:96160213-96160235 GGGAGGGAAGGGAGAGAAGAAGG + Intergenic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1057749945 9:97784341-97784363 TAGTGGGAATGGCTGGAAGGCGG - Intergenic
1057777542 9:98023082-98023104 TGGTGAGATTGGAAGGGAGATGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1058078074 9:100670731-100670753 TGGTGAGAATGTGGGGAAAAGGG + Intergenic
1058133749 9:101283984-101284006 TGGTGGGAATATAGAGAAAAGGG + Intronic
1058151882 9:101472679-101472701 TGTTGGGAGTGGGGGGAGGATGG + Intergenic
1058287118 9:103192014-103192036 GGGTGGGAATGAAGAGAAGCTGG + Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1058777598 9:108300354-108300376 CGGTGGGCATGGAGGCATGATGG - Intergenic
1058802172 9:108555235-108555257 TGGTGGGAGTGGGAGGGAGATGG + Intergenic
1058960449 9:109988510-109988532 AGGAAGGAAGGGAGGGAAGAAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059163476 9:112057128-112057150 TGGTGGGGATGGAGTGGGGAGGG - Intronic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059354243 9:113687113-113687135 GGTGGGGAAGGGAGGGAAGAGGG + Intergenic
1059354307 9:113687345-113687367 GGTGGGGAAAGGAGGGAAGAGGG + Intergenic
1059491818 9:114674216-114674238 TGGGTGGACAGGAGGGAAGAAGG - Intergenic
1059761347 9:117340532-117340554 TGGGGGGAATGAAGGCAAAATGG + Intronic
1059994085 9:119892547-119892569 TGGGGGGAAGGGAGGAAAGAAGG + Intergenic
1059994629 9:119896809-119896831 GGAAGGGAAGGGAGGGAAGAAGG + Intergenic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060236432 9:121866763-121866785 TGTTGGGAAGGGAGGGAGCAGGG + Intronic
1060399648 9:123340740-123340762 AGGTGGGGATGGAAAGAAGAAGG + Intergenic
1060510926 9:124231638-124231660 TGCTGGGAGTGAAGGGTAGATGG - Intergenic
1060786766 9:126457224-126457246 TGTTGGTGATGGAGGGAAGAAGG - Intronic
1060851052 9:126876183-126876205 GGGGGGGAAAGGAGGGAAGGGGG - Intronic
1061084371 9:128390572-128390594 AGGTGGGAAGGGAGAGAAAACGG - Exonic
1061150331 9:128824518-128824540 GGTTGGGAATGGAGGCAAAAGGG - Intronic
1061278825 9:129585391-129585413 GGGAGGGAGGGGAGGGAAGAAGG + Intergenic
1061306445 9:129735792-129735814 TGGTGGGTATGGAAGGGAGGTGG - Intergenic
1061339207 9:129965767-129965789 GGGAGGGAAGGGAGGGAAGGAGG + Intronic
1061412493 9:130429141-130429163 TGGTGAGAAAGGAGGAAAGGCGG - Intronic
1061455592 9:130695215-130695237 TGGGGGGAATGGTGGCAACAGGG + Intronic
1061584468 9:131557009-131557031 TGGGGTGAGTGGATGGAAGATGG - Intergenic
1061911049 9:133724518-133724540 TGGTGAGGATGGAGGGGAGCTGG + Intronic
1062254546 9:135614817-135614839 TGGTGGGAGTGCAGGGATGGAGG + Intergenic
1185485998 X:482033-482055 AGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1185492503 X:528656-528678 GGGAGGGAAGGGAAGGAAGAGGG - Intergenic
1185612158 X:1399121-1399143 ACGTGGGAAGGGAGGGAGGAGGG + Intergenic
1185621599 X:1453742-1453764 TGGTGGGAGGGGAGTGGAGATGG + Intronic
1185621734 X:1454084-1454106 GGGTGGGAAGGGCGGGGAGATGG + Intergenic
1185850681 X:3483328-3483350 TGGTGGGGATGCAGAAAAGAGGG - Intergenic
1185915003 X:4025686-4025708 AGGAGGGAAGGAAGGGAAGAAGG - Intergenic
1186020644 X:5251309-5251331 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
1186107097 X:6219393-6219415 GGGAGGGAATGAAGGAAAGAAGG - Intronic
1186137303 X:6533571-6533593 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186155179 X:6717833-6717855 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1186267141 X:7844168-7844190 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186269193 X:7866489-7866511 AGGTAGGAAGGGAGGAAAGAAGG - Intergenic
1186298004 X:8169897-8169919 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324846 X:8466535-8466557 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186657351 X:11629133-11629155 TGGTGGAGATGGAGGAAAGTAGG - Intronic
1187147537 X:16651180-16651202 TGGTGGGAGGGGAGGGAGGGAGG + Intronic
1187767359 X:22657503-22657525 TGGTGAGAATGCAGAGAAAATGG + Intergenic
1188000227 X:24973695-24973717 TGGTGGGAGGGGAGGGATTATGG - Intronic
1188330599 X:28866372-28866394 TGGAGGAAATGGTGGGAAGGAGG + Intronic
1188433135 X:30129561-30129583 TGGGGGGAAGAGGGGGAAGAGGG + Intergenic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1188832196 X:34912565-34912587 TGGTGGGGATGCAGTGAAAAAGG + Intergenic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1189083075 X:37994732-37994754 TGGTGGTGATGGGGGGAAGGAGG + Intronic
1189121386 X:38398986-38399008 GGGAGGGAATTGAGGGAAAAAGG - Intronic
1189485779 X:41430646-41430668 TGGTGGGAATGGAGGGTGGGGGG - Intergenic
1189760923 X:44320789-44320811 AGGAGTGAATGGAGGGGAGAAGG - Intronic
1190060310 X:47206571-47206593 TGGTGGGAAGTGAGGGAGGGAGG - Intronic
1190429458 X:50365338-50365360 TGGTGGAAATGGGGGGCAGGTGG - Intergenic
1190744269 X:53312168-53312190 TGGTGGGAATTGGGGGCAAAAGG - Intronic
1191042256 X:56095806-56095828 TGGTGGGGATGCAGAGAAAAAGG + Intergenic
1191720262 X:64223172-64223194 TGGTGGGAAGGCAGGGAAAATGG + Intergenic
1191745894 X:64486053-64486075 TGGGGTGAGGGGAGGGAAGAGGG + Intergenic
1191937728 X:66443037-66443059 AGGAGGGAATGGGGAGAAGAGGG - Intergenic
1192246156 X:69373348-69373370 TGGGGAGAATGGAGTGGAGAAGG - Intergenic
1192473413 X:71419335-71419357 TGGTGGGAATTGGAGGAAGTGGG - Intronic
1192502831 X:71664771-71664793 TGATAGGAGTGGAGGGGAGAGGG - Intergenic
1192848051 X:74925725-74925747 TGGTGGGGAAGAAGGGTAGAGGG - Intergenic
1193172680 X:78354911-78354933 TGGTGAGAATGTGGAGAAGAGGG - Intergenic
1193266058 X:79471100-79471122 TGGTGGAAATAAAGGAAAGAAGG - Intergenic
1193307546 X:79967103-79967125 TGGTGTGGATGGAGTGAAAAGGG - Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1193713275 X:84904135-84904157 TGGTGGGCAGGGAGGGATTAGGG - Intergenic
1193889364 X:87025402-87025424 TGTTGAGAATGCAGAGAAGAGGG - Intergenic
1194129450 X:90062540-90062562 TGGGGGGAAGGGAGGGAGGGAGG + Intergenic
1194256227 X:91638260-91638282 AGGAAGGAATGGAGGGAGGAAGG - Intergenic
1195000592 X:100639614-100639636 TGGTAGGGATGGAGGGAGGCTGG - Intronic
1195202536 X:102564761-102564783 AGGTGGGGAAGGAGGGAAGGTGG - Intergenic
1195546337 X:106116379-106116401 TGGAGGCAATGCAGGGAAGCAGG + Intergenic
1195656546 X:107336753-107336775 TGCTTGGTATGGAAGGAAGAGGG + Intergenic
1195696100 X:107668754-107668776 TGGTGAGAGTGGAGGCAGGAGGG - Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196210098 X:112986421-112986443 GGAGGGGAAGGGAGGGAAGAGGG + Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1196873008 X:120130365-120130387 CGATGGGAATGGAGGTAAGCAGG + Intergenic
1196896706 X:120344232-120344254 TTCTGGGAGTGGAGCGAAGATGG + Intergenic
1197078377 X:122379979-122380001 TGGTGAGAATGCAGGGAAGAGGG - Intergenic
1197188248 X:123613154-123613176 AGGTGGGAATGGAATGGAGAGGG + Intronic
1197234302 X:124041903-124041925 TGGTGGGTATGGAGTGGAGGTGG + Intronic
1197469003 X:126843752-126843774 TGGTGAGTATGTAGAGAAGAGGG + Intergenic
1197816537 X:130504448-130504470 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1197816547 X:130504486-130504508 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1197816562 X:130504537-130504559 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1197816574 X:130504575-130504597 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1197916970 X:131546193-131546215 TGGTTGGAATTGGGGGTAGAGGG - Intergenic
1198156999 X:133970731-133970753 TGGTGGGAAGGTGGGGAACAGGG + Intronic
1198160560 X:134003703-134003725 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
1198421367 X:136473074-136473096 AGGGAGGAATGAAGGGAAGAAGG + Intergenic
1198421381 X:136473119-136473141 AGGGAGGAATGAAGGGAAGAAGG + Intergenic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1198895900 X:141454261-141454283 TGGTGGGGATGTAGAGAAAAGGG + Intergenic
1199051198 X:143239036-143239058 TGGTGGGGATGGGGAGAGGAAGG - Intergenic
1199317058 X:146393471-146393493 TGGGGGGGAGGGAGGGAGGAAGG - Intergenic
1199825827 X:151498386-151498408 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199871716 X:151904384-151904406 TGGTGGGGAGGGAGGAAGGAGGG - Intergenic
1199896000 X:152128252-152128274 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200015966 X:153164115-153164137 TGGTGGGAAGAGAGGAAGGAGGG - Intergenic
1200574956 Y:4877544-4877566 AGGAAGGAATGGAGGGAGGAAGG - Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201578236 Y:15483587-15483609 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
1201625666 Y:16012049-16012071 TGGAGGGAATGAAGGAAAGATGG + Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1201933565 Y:19380957-19380979 TGTTGGGGTTGGAGGGAAGATGG - Intergenic
1202063177 Y:20909807-20909829 TGGTGGGTTTGGAGAGAAGGGGG + Intergenic