ID: 1184097305

View in Genome Browser
Species Human (GRCh38)
Location 22:42323455-42323477
Sequence CTGAGGGAACAGGAGGACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 480}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184097292_1184097305 20 Left 1184097292 22:42323412-42323434 CCTCAGAGGTCATTAGCATCACA 0: 1
1: 0
2: 4
3: 9
4: 142
Right 1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG 0: 1
1: 0
2: 4
3: 46
4: 480
1184097291_1184097305 21 Left 1184097291 22:42323411-42323433 CCCTCAGAGGTCATTAGCATCAC 0: 1
1: 0
2: 1
3: 20
4: 139
Right 1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG 0: 1
1: 0
2: 4
3: 46
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184097305 Original CRISPR CTGAGGGAACAGGAGGACGG TGG Intronic
900308727 1:2023418-2023440 CTGAGGGAGCAGGAGGCCAAGGG + Intronic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900974945 1:6011158-6011180 CTGAGGGAGCAGCAGGAGTGAGG + Intronic
900983273 1:6058733-6058755 AGGAAGGAACAGGAGGAGGGAGG + Intronic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901427355 1:9190891-9190913 ATCAGGGAACAGGAGGAAAGGGG - Intergenic
901775980 1:11560658-11560680 CTGGGGGAACAGGGGGATCGGGG + Intergenic
901817039 1:11800286-11800308 CAGTGGGAAGAGGAGGAGGGAGG - Exonic
902275034 1:15333343-15333365 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
902777281 1:18682890-18682912 GTGAGGGTACAGGAGCAGGGAGG - Intronic
902830938 1:19012082-19012104 GTGAGGGGCCAGGAGGACTGCGG + Intergenic
903765765 1:25733201-25733223 CTTACGGATGAGGAGGACGGGGG - Intronic
903774002 1:25781489-25781511 CTGTGGGAAGAGGAGGGAGGTGG - Intronic
904266722 1:29322572-29322594 CTGAGGCAAAATGAGGAAGGTGG + Intronic
904311538 1:29632661-29632683 CTGAGGGGCCAGGAGGCTGGGGG - Intergenic
904840743 1:33370370-33370392 CAGAGGCACCAGGAGGACAGAGG - Intronic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905174043 1:36125257-36125279 CTGTGGAAAGAGGAGGGCGGAGG - Intergenic
905449545 1:38047508-38047530 CTCAGGGCAGAGGAGGTCGGCGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
909914756 1:81303133-81303155 GTGAATGAACACGAGGACGGAGG - Intergenic
910231204 1:84988903-84988925 CTGGGGGAACAGCAGTAGGGTGG - Intronic
910446095 1:87300188-87300210 GGGAGGGCAGAGGAGGACGGGGG - Intergenic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
912143241 1:106757617-106757639 CTGAGGGAACATGTGCACTGAGG - Intergenic
912312488 1:108637802-108637824 CTCAGGGCACAGGAGGAGGTGGG - Exonic
913072748 1:115315455-115315477 GTGAGGGAACAGGGGGATCGAGG + Intronic
913079212 1:115366151-115366173 CTAAGGGAACTGGAGGAGTGTGG + Intergenic
913113072 1:115673213-115673235 GTGAGAGAACGGGAGGAAGGAGG - Intronic
914720201 1:150282966-150282988 CTGAGGGAAGAAAAGAACGGAGG + Exonic
914915004 1:151814277-151814299 TTGATGGAAGAGGAGGAAGGAGG + Intronic
915162351 1:153929479-153929501 CCCAGGGAACAGGAGGCCGAAGG + Exonic
915480048 1:156178270-156178292 CAGAGGGTAGAGGAGGAAGGTGG - Intergenic
915939807 1:160111997-160112019 CTGAGGGAGTGGGAGGACAGAGG + Intergenic
916733410 1:167586288-167586310 CTGGGGGAAAAGGAGGACCTAGG - Intergenic
918124328 1:181569395-181569417 CTGAGGGAAGAGGACGAGGCTGG - Intronic
920088348 1:203434348-203434370 ATGAGAGAAGAGGTGGACGGGGG - Intergenic
920118179 1:203636042-203636064 CTGAGGGAACCTGGGGACTGAGG + Intronic
920365757 1:205447631-205447653 CTGAGTGACAAGCAGGACGGGGG + Intronic
921064008 1:211609934-211609956 CTGAGGGAACAGGAGCTGGAAGG - Intergenic
921685289 1:218082871-218082893 TTGAGGAACCAGGAAGACGGGGG - Intergenic
922096303 1:222445878-222445900 ATGAGGGGACATGAGGAGGGAGG - Intergenic
922614168 1:226951351-226951373 CTGAAGCGACAGGAGGAGGGAGG + Intronic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
922722661 1:227906571-227906593 ATGAGGGAGTAGGAGGAGGGAGG - Intergenic
922775700 1:228213383-228213405 CGGAGGGTGCAGGACGACGGCGG - Intronic
923062255 1:230486857-230486879 CTCAGGGAAAAGGAAGACAGTGG + Intergenic
923804966 1:237247710-237247732 TTGAGGTACCAGGAGGAAGGTGG + Intronic
924829410 1:247577362-247577384 CTCAGGGAAAAGGAGCACTGTGG - Exonic
1063438333 10:6052551-6052573 TTGAGGGTACAGGAGGAAGAGGG - Intronic
1064225814 10:13483821-13483843 CTGGGGGTACGGGAGGAAGGGGG + Intronic
1064704312 10:18056167-18056189 CTGAGGGGAAAGGAGGAAGTTGG + Intergenic
1066292237 10:34025129-34025151 CTTAGGGACCTGGAGGAAGGGGG - Intergenic
1067767014 10:49094501-49094523 CTGAGGGACCTGGAGCAGGGTGG - Intronic
1067806451 10:49396348-49396370 CTGAGGGGACATGAGGTGGGGGG - Intergenic
1068538652 10:58267970-58267992 CTGAGGGGACTGGAGGACGGCGG - Intergenic
1069690243 10:70347127-70347149 CTTAGGGAACATGAGGCAGGTGG - Intronic
1069961251 10:72080735-72080757 CTGAGGGCAGAGGAGGTGGGAGG - Intronic
1070706837 10:78645922-78645944 CTTAGGGAACAGGGGGAAGGAGG - Intergenic
1070985592 10:80687008-80687030 ATGATGGAACAGGAGGTCAGAGG + Intergenic
1071753546 10:88509497-88509519 GGGAGGGGACAGGAGGGCGGGGG + Intronic
1072506484 10:96072884-96072906 CTCATAGAACAGGAGGACAGAGG - Intergenic
1072549277 10:96465094-96465116 CTCAGGGAACTGGAGGAGAGAGG + Intronic
1072601034 10:96929862-96929884 CTCAGGGAATAGGAGGTCGAAGG + Intronic
1073073127 10:100807377-100807399 GTGAGGGAGCAGGTGGGCGGTGG - Intronic
1073073139 10:100807428-100807450 GTGAGGGAACAGGTGGGCGGTGG - Intronic
1073073162 10:100807530-100807552 GTGAGGGAGCAGGTGGGCGGTGG - Intronic
1073084964 10:100882437-100882459 GTGAGGGAAGAGGAGGAGAGGGG + Intergenic
1073458180 10:103650256-103650278 CTGAGGTCCCAGGAGGACTGGGG - Intronic
1073818847 10:107237056-107237078 CTGAGGGACCAGCAGGAAAGGGG + Intergenic
1074527925 10:114277854-114277876 ATGAGGGGGCAGGAGGAGGGTGG + Intronic
1074955873 10:118388636-118388658 GTGAGGACACAGGAGGAAGGTGG + Intergenic
1075635229 10:124026131-124026153 CTGAGGGTAGGGGAGGACTGGGG + Intronic
1075744265 10:124715596-124715618 CTGAGGCCACAGGATGACTGAGG - Intronic
1075835373 10:125448421-125448443 CCTAGAGAACAGGAGGACGAAGG - Intergenic
1075887314 10:125912354-125912376 CTAAAGGAAGAGGAGGAGGGGGG - Intronic
1075913592 10:126147357-126147379 CAGAGGGAACAGGAGGGGAGAGG - Intronic
1076590003 10:131576530-131576552 CTGATGAAAGAGGAAGACGGTGG + Intergenic
1076614090 10:131744863-131744885 CTGGGGGGACAGGAGTACGGGGG + Intergenic
1076786610 10:132752772-132752794 CTGAGAGAAAAGGAGGACTTTGG - Intronic
1076891126 10:133284003-133284025 CTGAGTGACACGGAGGACGGAGG + Intronic
1077147689 11:1053300-1053322 CTGTGGGAACTGCAGGAAGGAGG - Intergenic
1077268958 11:1666211-1666233 CAGAGGGTCCAGGAGGACAGGGG - Intergenic
1077301609 11:1849826-1849848 CTGGGGGACCGGGAGGAAGGTGG + Intergenic
1077304856 11:1864444-1864466 CTGAGGGCAGAGGCGGAGGGAGG + Intronic
1077827499 11:5826734-5826756 CTGGGGGATCTGGAGGACTGTGG - Intronic
1078264998 11:9748642-9748664 CTGAAGGGACACGAGGAGGGAGG - Intronic
1079098005 11:17523268-17523290 CTGTGGGGACAGAAGGACAGTGG + Intronic
1079348331 11:19672100-19672122 CTGAGGGAACAGCAAGCCAGGGG + Intronic
1079862603 11:25692835-25692857 CTGAGGGAAAGGGTGGAAGGGGG - Intergenic
1082982635 11:59137362-59137384 CTGAGGTACCAGGAAGATGGAGG + Intergenic
1083159115 11:60843775-60843797 GTGAGGGACCATGAGGAAGGAGG + Intronic
1083725024 11:64623416-64623438 CTGAGGGAAGAGGATGAAGAGGG - Intronic
1083860565 11:65417995-65418017 GTGAGTGCTCAGGAGGACGGGGG + Intergenic
1083880078 11:65544016-65544038 CTGAGGCTGCAGGAGGCCGGCGG - Intronic
1084642494 11:70434205-70434227 CTGAGGGAACACGGGGCGGGCGG - Intronic
1084689650 11:70717594-70717616 CTGCGGGGACGGGAGGACCGTGG - Intronic
1084788428 11:71457755-71457777 AGGAGGCAACATGAGGACGGAGG - Intronic
1084945150 11:72634315-72634337 CTGTGGGAAGAGGAAGACGGAGG + Intronic
1088332749 11:108670319-108670341 GAGAGGGAACAGGAGTAGGGAGG + Intronic
1088753868 11:112868928-112868950 CTGAGGCCACAGGAGGAAAGAGG - Intergenic
1089998027 11:122927606-122927628 CTGAGGGCAGAGGAGCAGGGTGG - Intronic
1091324697 11:134677481-134677503 AGGAGGGAACAGGAGGTTGGCGG - Intergenic
1091718988 12:2798736-2798758 CTGACGGAAGAGGAAGATGGCGG + Exonic
1094077469 12:26493084-26493106 CTGAGGGAATTTGAGGAAGGAGG - Intronic
1095508099 12:42920018-42920040 ATGAGGGAACAGTAGGTCAGAGG + Intergenic
1095990108 12:48028641-48028663 CTGAGGGAGGTGGAGGACAGTGG + Intergenic
1097027044 12:56064440-56064462 CTGAGGAAACAGGCGGATGGTGG + Intergenic
1098198355 12:68026628-68026650 CTGAGGAAACAGAATCACGGTGG - Intergenic
1100892575 12:99142117-99142139 CTGAGGGTACAGGCGGAAGCAGG + Intronic
1102346968 12:112166790-112166812 CTGAGTGAACGGAAGGACTGTGG + Intronic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1103553382 12:121751472-121751494 CTGAAGGAACAGAATGCCGGAGG - Intronic
1103870139 12:124085457-124085479 CTGGGGGAACAGGGTGATGGGGG + Intronic
1104124963 12:125837678-125837700 GTGAGGGAAAAGGAGGGAGGAGG + Intergenic
1104610805 12:130226179-130226201 CTGGGGGACCAGCAGGACGTGGG - Intergenic
1106099439 13:26681785-26681807 CTCAGGGAACAGGAGGGCCTGGG - Intronic
1106172048 13:27296695-27296717 CTCAGGGAGCAGGAGGATGCAGG - Intergenic
1106447668 13:29850663-29850685 CGGAGGGAGGACGAGGACGGGGG - Exonic
1107557226 13:41527378-41527400 CTGAGGGAAAGGGAGGACTCAGG - Intergenic
1108544595 13:51480229-51480251 CAGAGGGAACAAGAAGACTGAGG - Intergenic
1108643570 13:52405902-52405924 CTGAAGGCGCAGGTGGACGGTGG - Intronic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1110767034 13:79292432-79292454 ATGAGGGAACATGGAGACGGAGG - Intergenic
1111831735 13:93338855-93338877 CTGAGGGAGCAGGAAGATGGAGG - Intronic
1112321056 13:98407978-98408000 CTAAGGGAAAAGGTGGAGGGCGG - Intronic
1113391625 13:109903400-109903422 CTGAGGGAATAGCAGGAGAGAGG + Intergenic
1114311101 14:21468040-21468062 CTGAGGGATGAGGGGGATGGGGG + Intronic
1115343022 14:32312175-32312197 CTGAGGGAAGAGGAAGATGCAGG + Intergenic
1115403871 14:32994110-32994132 CTGGGGGAGCTGGAGGAAGGGGG + Intronic
1117070178 14:52049052-52049074 CTCAGGGCACAGCAGGAGGGTGG + Intronic
1119163991 14:72477123-72477145 CTGTGGGAGCTGGAGGAAGGAGG + Intronic
1120723296 14:87910742-87910764 CTGAGGGTAGAGGAGGGAGGAGG - Intronic
1121389833 14:93564503-93564525 TTGAAGGAGCAGGAGGACAGGGG + Intronic
1121466036 14:94116081-94116103 CTGAGGGAGATGGAGGAGGGAGG + Intronic
1121521069 14:94586650-94586672 CAGCCAGAACAGGAGGACGGTGG + Intronic
1121970837 14:98354606-98354628 CTGAGGGAACAGGAATACCAAGG + Intergenic
1122716326 14:103698847-103698869 GTGTAGGAACAGGAGGAGGGGGG + Exonic
1122784807 14:104158718-104158740 CAGAGGGAACAGGAGAGCAGAGG + Intronic
1122854690 14:104554442-104554464 CTTAGGGAACAGCAGGACAGAGG - Intronic
1123025506 14:105421851-105421873 CTGCGGGCACAGGGGGACAGAGG - Intronic
1202904393 14_GL000194v1_random:59985-60007 CTCAGGGAAGAGGAGGCCGGAGG - Intergenic
1202870808 14_GL000225v1_random:161645-161667 CTAAAGGAAGAGGAGGAGGGGGG + Intergenic
1126688810 15:51271413-51271435 CTGAGAGTACAGGAAGACAGGGG - Intronic
1126757150 15:51935955-51935977 CTGAGGGAACATAGGGACGAGGG + Intronic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1127819199 15:62640370-62640392 CAGAGAGAAGAGGGGGACGGTGG + Intronic
1128154285 15:65383073-65383095 CTGAGTGAAGAGGAGGCAGGAGG + Exonic
1128698985 15:69790154-69790176 CTGAGGGAAAAGGAGGATGTGGG - Intergenic
1129667617 15:77588288-77588310 CAGAAGGACCAGGAGGACAGAGG + Intergenic
1129684026 15:77674606-77674628 CAGAGGGAACAGCAGGTCTGAGG - Intronic
1129685144 15:77681743-77681765 ATGAGGGGACAGGTGGAGGGAGG + Intronic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1132514578 16:360190-360212 CGGAGGGCACAGGTGGGCGGGGG - Intergenic
1132592873 16:733974-733996 CTGAGGGAGCAGGAGGCCCTGGG - Intronic
1132869748 16:2110650-2110672 CTGTGGGATCTGGGGGACGGTGG - Exonic
1133033001 16:3020570-3020592 CTGGGGGAACAGGCGGATGTGGG + Intronic
1134316891 16:13127109-13127131 CTGAGGGAACAGAGAGAGGGAGG + Intronic
1134717673 16:16364951-16364973 CTGTGGGATCTGGGGGACGGTGG + Intergenic
1134957079 16:18387208-18387230 CTGTGGGATCTGGGGGACGGTGG - Intergenic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1135893991 16:26381929-26381951 CTGAGGACACAGGAGGAAGCAGG - Intergenic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136555270 16:31003902-31003924 ATGAGGGAACAGGAAGCCAGGGG + Intronic
1137311678 16:47267026-47267048 CTGAGGGAATTGGAGGAAAGGGG + Intronic
1137592857 16:49704333-49704355 CTGAGGGACCCAGAGGAGGGAGG - Intronic
1138328267 16:56192508-56192530 TTAAGGGAACAGGGGGAGGGGGG - Intronic
1139301115 16:65946184-65946206 GTGAGGGATGAGGAGGAAGGAGG - Intergenic
1139545884 16:67649361-67649383 CTGAGGGAACAAGAGAAAGGAGG - Intronic
1141219933 16:82059994-82060016 CTGAGGGCAAAGGAGGAGGGAGG + Intronic
1141686572 16:85573771-85573793 CTGAGGCAACTGGTGGCCGGAGG - Intergenic
1141812260 16:86383421-86383443 CTGAGGGCACAGGAGTAGGGAGG - Intergenic
1142161212 16:88558627-88558649 CCCAGGGAACGGGAGGACGCAGG - Intergenic
1142246084 16:88970691-88970713 CTGAAGGACCAGGAGCACGGAGG + Intronic
1142981744 17:3676404-3676426 CTGGGGAACCGGGAGGACGGAGG + Intronic
1142992195 17:3739011-3739033 ATGAGGGAAGGGGAGGAAGGGGG - Intronic
1143139570 17:4733721-4733743 CTGCGGGTACAGGAGGATGCAGG + Exonic
1143208837 17:5167902-5167924 TAGAGGGAACAGGAGGAAAGGGG - Intronic
1143564010 17:7710571-7710593 CTGGGGGATCAGGAGGTGGGAGG + Exonic
1143571098 17:7759163-7759185 CTGATGGAACTGGGGGACTGTGG - Intronic
1143779662 17:9222580-9222602 GTGAGGAAAGAGGAGGAGGGAGG + Intronic
1143861815 17:9896908-9896930 CTGAGGGGGCAGGAGGAGAGAGG - Exonic
1144504850 17:15821289-15821311 CTGAAGGACAAGGAGGACGCGGG - Intergenic
1144618161 17:16796013-16796035 TGGAGGGAACAGGAGGAAAGGGG - Intronic
1144894543 17:18519682-18519704 TGGAGGGAACAGGAGGAAAGGGG + Intergenic
1145137683 17:20424562-20424584 TAGAGGGAACAGGAGGAAAGGGG - Intergenic
1145169023 17:20639172-20639194 CTGAAGGACAAGGAGGACGCGGG - Intergenic
1146182588 17:30707639-30707661 TAGAGGGAACAGGGGGAGGGGGG - Intergenic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146905934 17:36617927-36617949 CCGAGGGCACAGGAAGCCGGTGG - Intergenic
1147281564 17:39365903-39365925 CTAAGGGAAATGGAGGAAGGAGG - Intronic
1147745144 17:42690293-42690315 GTGAGGGTAAAGGAGGACAGAGG + Intronic
1147915530 17:43883158-43883180 GTGAGGGAGCAGGAGGTGGGTGG - Intronic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148130342 17:45258362-45258384 CTGGGGGAACAGCAGGACCTGGG - Intronic
1149537857 17:57446281-57446303 TTCAGGGAACAGAAGGAAGGAGG + Intronic
1149580235 17:57744950-57744972 CTAAGGGAGGAGGAGGACCGTGG - Exonic
1149868083 17:60161665-60161687 CGGAGGGAAAGGGAGGAGGGAGG - Intronic
1149871453 17:60185659-60185681 TAGAGGGAACAGGAGGAAAGGGG + Intronic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151493171 17:74444451-74444473 GGGAGGGAGCAGGAAGACGGTGG + Intronic
1151800860 17:76378869-76378891 CTAAGGGTACAGGAGGAAAGGGG - Intronic
1151820632 17:76494928-76494950 CTGAGGGAGCAGGAGAACTGGGG - Intronic
1151990766 17:77572579-77572601 CTGAGGAAACAGCAGGGAGGAGG - Intergenic
1152000077 17:77639892-77639914 AGGAGGGAAGAGGAGGAGGGAGG - Intergenic
1152000085 17:77639915-77639937 AGGAGGGAAGAGGAGGAGGGAGG - Intergenic
1152598372 17:81249247-81249269 GTGGGGGAAGAGGAGGAGGGAGG + Intronic
1152598381 17:81249277-81249299 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152598386 17:81249294-81249316 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152598391 17:81249311-81249333 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152598396 17:81249328-81249350 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1153182575 18:2451753-2451775 CTGGGGGCAAAGGAGGATGGGGG + Intergenic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1155066576 18:22273873-22273895 AGGAGGGAAGAGGAGGAGGGAGG - Intergenic
1155066592 18:22273922-22273944 AGGAGGGAAGAGGAGGAGGGAGG - Intergenic
1155066601 18:22273948-22273970 AGGAGGGAAGAGGAGGAGGGAGG - Intergenic
1155066615 18:22273987-22274009 AGGAGGGAAGAGGAGGAGGGAGG - Intergenic
1155096542 18:22560926-22560948 CTGCGGTAACAGTAGGAGGGTGG + Intergenic
1156757576 18:40547077-40547099 CTCAGGGAACAGGAGGGGGCTGG + Intergenic
1157163473 18:45336573-45336595 ATGAGGTAACAGGGGGACAGAGG - Intronic
1157439307 18:47697776-47697798 CTGAGGGAACGTGAGGGCTGAGG - Intergenic
1158489309 18:57895437-57895459 CTGAGCAAACAGGAAGACGCTGG - Intergenic
1160835288 19:1122070-1122092 CGGAGGGAAAAGGAGGATGGAGG - Intronic
1161010847 19:1958770-1958792 ATGGGGGGACAGGGGGACGGGGG - Intronic
1161085551 19:2333318-2333340 TTGCGGGAGCAGGAGGAAGGTGG + Intronic
1161477685 19:4495567-4495589 GAGAGGGAAAAGGAGGGCGGTGG + Intronic
1161576537 19:5057703-5057725 CTGTGGGATCAGGAGGGCAGCGG + Intronic
1161612096 19:5248806-5248828 CTGAGGCTCCAGGAGGATGGGGG - Intronic
1162462150 19:10819650-10819672 GTGAGGGAAAAGGAGGATGGAGG + Intronic
1163049765 19:14673870-14673892 CTGAGGGAGTAGAAGGACAGTGG - Intronic
1163482109 19:17562932-17562954 GTGAGGAAACAGGCTGACGGAGG + Intronic
1163826414 19:19527171-19527193 CTGGGGGAAGAGGCGGAGGGGGG - Intronic
1164464359 19:28475043-28475065 CTGAGGGAGCAGGGGGTGGGCGG - Intergenic
1165098901 19:33426740-33426762 CTGAGGAAACAGGAGGAGCTGGG + Intronic
1165249124 19:34515537-34515559 CTGAGGGGACAGGCGGGGGGGGG - Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166296691 19:41893378-41893400 CTGAGGGAGGAGGAGGCTGGGGG + Intronic
1166296803 19:41893648-41893670 CTGAGGGAGGAGGAGGCTGGGGG + Intronic
1166313461 19:41976025-41976047 CTGAGGGAGAAGGAGGCTGGGGG - Intronic
1166571834 19:43802125-43802147 CTGAGGGAGGAGGAGGCTGGGGG - Intronic
1166800753 19:45455752-45455774 CTGTGGGAACAGCAGGGCTGGGG - Intronic
1167094504 19:47367164-47367186 CTGAGTGATCAGGAGGGGGGTGG - Intronic
1167253534 19:48414293-48414315 CTGAGGGAAGAGGATCATGGAGG + Intronic
1167409766 19:49338035-49338057 GGGAGGGAACTGGAGGAGGGGGG - Intronic
1167413785 19:49360209-49360231 CTGAGGGAAGAGGAGCTGGGGGG + Intronic
1167577399 19:50324389-50324411 CACAGGGAACAGGAGGGTGGGGG - Intronic
1167668980 19:50838943-50838965 CTGAGGGAGGAGGAGGCTGGGGG + Intergenic
1167716350 19:51144796-51144818 TTGTGGGATCAGGAGGACGCTGG + Intronic
1168077684 19:53990386-53990408 CTGAGGGAGGAGGAGGGCCGGGG - Intergenic
1168254455 19:55158014-55158036 CTGAGGGAAAAGGGGGCTGGGGG - Intronic
925221392 2:2144217-2144239 CTGAGGGCAGAGCAGGAGGGAGG - Intronic
925294801 2:2769374-2769396 CTGAGGGACTAGGAGGAAGGAGG - Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927641718 2:24849741-24849763 CAGAGGGGAAAGGAGGAGGGGGG + Intronic
929945803 2:46370942-46370964 CTGAGGAAAAAAGAGGACCGTGG + Intronic
930262676 2:49165797-49165819 CTGAGGGACCGGGAAGAAGGAGG + Intergenic
930273836 2:49288389-49288411 CTGAGGGAAGAGCAGGAGAGAGG - Intergenic
930771943 2:55137934-55137956 CTGAGAGGACATGAGGATGGAGG - Intergenic
930804214 2:55473919-55473941 CTGTGGGTAGAGGAGGAAGGGGG + Intergenic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
932509471 2:72271128-72271150 CTGAGGGAACAGGTGGTATGAGG + Intronic
932666795 2:73704728-73704750 CTCTGGGAACAGGATGATGGTGG + Intergenic
932719879 2:74131084-74131106 GTGAGGGAACGGGAGAGCGGAGG - Intronic
934502253 2:94870415-94870437 CTCAGAGAAGAGGAGGCCGGAGG + Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
939647373 2:144717181-144717203 CGGAGGGGACAGGAGAACGGAGG + Intergenic
940467271 2:154046791-154046813 CTGAGGATACAGGAAGAAGGTGG + Intronic
940971302 2:159899782-159899804 CTGAGGGAGCAGCAGAACAGTGG + Intronic
942578337 2:177390196-177390218 TTGATGGAACAGGATGACAGTGG + Intronic
944882275 2:204025908-204025930 CCCTGGGCACAGGAGGACGGAGG - Intergenic
945212100 2:207394437-207394459 CTGAGGTTACAGAAGGAAGGAGG + Intergenic
946029035 2:216690754-216690776 CGGAGGGAAGAGTAGGAGGGAGG + Intronic
946311387 2:218884131-218884153 TAAAGGGAACAGGAGGACAGAGG - Intronic
946325136 2:218981150-218981172 GTGTGGGGACAGGAGGAAGGGGG + Exonic
947295236 2:228623662-228623684 ATGAGGGAACAGGAAGGTGGTGG + Intergenic
947830773 2:233139996-233140018 CTGAGGGCTCAGGAGGAAGAGGG + Intronic
948137572 2:235648218-235648240 CTGAGGGCACAGGAGGTGGAGGG - Intronic
948579042 2:238971678-238971700 CTGTGGTAACAGGAGGCAGGGGG - Intergenic
949025375 2:241765278-241765300 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025393 2:241765328-241765350 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025411 2:241765378-241765400 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025429 2:241765428-241765450 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025447 2:241765478-241765500 CTGAGGGATTAGGAAGAGGGGGG + Intronic
949025465 2:241765528-241765550 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025483 2:241765578-241765600 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025501 2:241765628-241765650 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025519 2:241765678-241765700 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025537 2:241765728-241765750 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025555 2:241765778-241765800 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025574 2:241765828-241765850 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025592 2:241765878-241765900 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025610 2:241765928-241765950 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025628 2:241765978-241766000 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025646 2:241766028-241766050 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025680 2:241766128-241766150 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025698 2:241766178-241766200 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025716 2:241766228-241766250 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025734 2:241766278-241766300 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025752 2:241766328-241766350 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025771 2:241766378-241766400 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025789 2:241766428-241766450 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025807 2:241766478-241766500 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025825 2:241766528-241766550 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025843 2:241766578-241766600 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025861 2:241766628-241766650 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025879 2:241766678-241766700 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025897 2:241766728-241766750 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025915 2:241766778-241766800 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025933 2:241766828-241766850 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025951 2:241766878-241766900 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025969 2:241766928-241766950 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025987 2:241766978-241767000 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026005 2:241767028-241767050 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026023 2:241767078-241767100 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026041 2:241767128-241767150 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026059 2:241767178-241767200 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026077 2:241767228-241767250 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026095 2:241767278-241767300 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026113 2:241767328-241767350 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026131 2:241767378-241767400 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026149 2:241767428-241767450 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026167 2:241767478-241767500 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
1168867135 20:1096619-1096641 GGGAGGGAACATGAGGAGGGGGG - Intergenic
1169458759 20:5776368-5776390 ATGAGGACACAGGAAGACGGTGG - Intronic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171093278 20:22306406-22306428 GTGAGGGGACAGGAGCACAGGGG - Intergenic
1171776902 20:29377176-29377198 GTGAGGGAACAGGGGGATAGTGG - Intergenic
1172471148 20:35197408-35197430 GTGAGGGAACAGGTGGTCAGTGG - Intergenic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1174142539 20:48425916-48425938 CTGAGGGAGCAAGAGGGAGGGGG - Intergenic
1174291175 20:49509831-49509853 TTGAGGGAAAAGGGGGACTGGGG - Intronic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1175715950 20:61253920-61253942 CTGAAGGAGCAGGAGCACAGCGG - Intronic
1175741846 20:61425257-61425279 CTCCGGGAACAGGAGCAGGGAGG + Intronic
1175841725 20:62032260-62032282 CTCAGGGAGCAGGAGTTCGGGGG - Intronic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1176187209 20:63787388-63787410 CTGAGGGAACATGAAGGCTGAGG - Intronic
1176199125 20:63852332-63852354 CTTAGGGACCAGGAGGAATGAGG - Intergenic
1176330389 21:5544618-5544640 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176397368 21:6276333-6276355 CAGAGGAAAAAGGAGCACGGAGG - Intergenic
1176439789 21:6712771-6712793 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176464051 21:7039840-7039862 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176487612 21:7421619-7421641 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176623761 21:9074752-9074774 CTCAGGGAAGAGGAGGCCGGAGG - Intergenic
1178701412 21:34836335-34836357 CTGAGGGAAAGGGATGATGGGGG - Intronic
1180202049 21:46229760-46229782 CAGAGGGAAGAGGAAGATGGAGG + Intergenic
1180203625 21:46243465-46243487 CTGATGTAACAGGAAGCCGGGGG + Exonic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1180693677 22:17738578-17738600 CTGAATGGACAGGAGGAAGGGGG + Intronic
1180698632 22:17769908-17769930 CTGAGGGCACCGGAGGCCAGCGG - Intronic
1181311810 22:21948977-21948999 CTGAGGGAACAGGCCGATTGTGG - Intronic
1181316011 22:21971261-21971283 CTGGGGGTACAGGAGCACGGGGG + Intronic
1181515786 22:23411473-23411495 CTGAGGGAACAGCTGGTTGGTGG - Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1182234730 22:28866358-28866380 CTGAGGGAATAGCAGGATGAGGG + Intergenic
1182265233 22:29109530-29109552 GTCAGGGAACAGCAGGACAGAGG + Intronic
1182540693 22:31039663-31039685 CCGAGGGAACAGGATGGAGGGGG + Intergenic
1183270431 22:36859113-36859135 CTGAGGGAAGAGGAGGACATTGG - Intergenic
1183284305 22:36952775-36952797 CAGAGGACAGAGGAGGACGGAGG - Intergenic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1183512322 22:38243456-38243478 CTGAAGGAACAGGTGGGCAGAGG + Intronic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
1185181380 22:49365459-49365481 CTGGAGGAGCAGGAGGATGGTGG - Intergenic
949459679 3:4276958-4276980 CTGAGGGAAGATGGGGATGGTGG + Intronic
950159611 3:10750269-10750291 GTGAGGGAACATGAGGATGGTGG - Intergenic
950471589 3:13189763-13189785 CTGGGGGAACAGGAGGACCTGGG - Intergenic
952916627 3:38250818-38250840 CAGAGGGAACAGGAGGACTGCGG - Intronic
953036683 3:39217672-39217694 CTGAGGGATGAGGGGGACTGTGG - Intergenic
953228970 3:41046404-41046426 CTGGGGAAACTGGAGGAAGGGGG - Intergenic
953869403 3:46613566-46613588 CTGAGGGCAAAGGAGCATGGGGG - Intronic
955214028 3:56970028-56970050 CTGGGGGAAGAGGAGGAATGAGG + Intronic
955982349 3:64539744-64539766 CCTAGGCAACAGGAGGACAGAGG - Intronic
956718194 3:72096693-72096715 CTGGGTGAACAGGAGCATGGTGG - Intergenic
959665603 3:108917569-108917591 ATGTGGGAGCAGGAGGACGCAGG + Intronic
959893312 3:111580660-111580682 CAGAGGGAAGGGGAGGACAGAGG - Intronic
959916580 3:111823138-111823160 CTAAGGGACCAGGAGGAAGTGGG + Intronic
960160049 3:114340424-114340446 CTGAGAGCAAAGGAGGACGCAGG - Intronic
960508807 3:118524299-118524321 CTGAGGATACAGGAGGAAAGAGG - Intergenic
960726029 3:120671084-120671106 CTGAAGAAACTGGAGGACGAAGG - Intronic
960986546 3:123284739-123284761 GTGGGGGAACAGGAGGAGAGAGG + Intronic
968009222 3:195262323-195262345 CAGGGGAGACAGGAGGACGGAGG + Intronic
968588527 4:1446172-1446194 CTGAGGGACCAGCAGGGTGGAGG + Intergenic
969212365 4:5697508-5697530 GTGAGGGAGCTGGAGGAAGGAGG + Intronic
969545560 4:7824748-7824770 CTGAGGGAACGGGAGGAAGGGGG + Intronic
969858269 4:10017195-10017217 CTATGGGAACATGAGGACGGAGG - Intronic
969882642 4:10187790-10187812 CTGAGGGGACAGTTGGAAGGTGG + Intergenic
969884421 4:10202473-10202495 CTGAGGGAACAGGTTGAAGGTGG + Intergenic
970436928 4:16044827-16044849 CTGAGGGGACAGGGGGAAGTAGG + Intronic
970712916 4:18885128-18885150 AGGAGGGAACAGGTGGACAGAGG + Intergenic
971269386 4:25126307-25126329 GTGAGGGAAAAGGAGGTCAGAGG + Intronic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
978827997 4:113047775-113047797 CTGCTGAAACAGGAGGAGGGTGG + Intronic
979280819 4:118865688-118865710 CTTTGGAAACAGGAGGAAGGAGG + Intronic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
985695307 5:1336831-1336853 CTGAGGGAACAGCAGTACAGGGG + Intronic
986384444 5:7217854-7217876 CTGTGGGAGCATGAGGAAGGAGG - Intergenic
986418611 5:7553660-7553682 CTGAGGGGACAGAAGCAGGGAGG + Intronic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
990979659 5:61591352-61591374 CTGAGGGTACAAGTGGACAGAGG + Intergenic
992034967 5:72764169-72764191 AGGAGGGAAAAGGAGGATGGAGG - Intergenic
992386275 5:76287631-76287653 CAGAGGGAACAGCAGCACTGTGG - Intronic
992741104 5:79774412-79774434 CTGAGGAAACAGCAGAACGGTGG - Intronic
992813005 5:80408189-80408211 CTGTGGGAACAGCAGGGCTGAGG - Intronic
994151721 5:96455657-96455679 CTGAGGGAACGGCAGGACTGAGG - Intergenic
994513693 5:100742255-100742277 CTGGGGGAAAAGGAGGGAGGGGG + Intergenic
994678182 5:102851021-102851043 CTGCTGGAACAGGAGGAAAGAGG + Intronic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
995741984 5:115365100-115365122 GTGAGGGAACAAGAGAAGGGAGG - Intergenic
995882588 5:116859334-116859356 CTGAGGGAAAAGGAAGATAGGGG - Intergenic
996093716 5:119376566-119376588 CTGGGGGAGCAGAAAGACGGGGG - Intronic
996815114 5:127565869-127565891 CTGAGGGGAGGGGAGGATGGTGG - Intergenic
996834618 5:127777061-127777083 CTCAGGGATCTGGAGGACAGTGG - Intergenic
997568199 5:134905293-134905315 CTGAGGGACCAGCGGGACTGGGG + Intronic
998069105 5:139182777-139182799 CTGAGGACACAGGAGCAGGGGGG + Intronic
998487113 5:142512508-142512530 CTGAGGGAGCAAAAGGACAGAGG - Intergenic
998888249 5:146717845-146717867 CTAAGGAAAAGGGAGGACGGGGG - Intronic
999269493 5:150288605-150288627 CTGAGGCAGCAGGAGCACGGGGG - Intronic
1001475011 5:172044336-172044358 CTGGGAGAACAGGAGGAATGAGG + Exonic
1001686252 5:173597050-173597072 CTGGGGGAAAAGGAGGCTGGAGG - Intergenic
1002924900 6:1599679-1599701 CTGAGGAAGCACGAGGACTGTGG - Intergenic
1004370110 6:15044894-15044916 CTTAGGGAAAAGGAAGATGGTGG - Intergenic
1005411352 6:25550793-25550815 CTCAGAGAACAGGAGCACGACGG - Intronic
1005500635 6:26426268-26426290 ATGAGAGACCACGAGGACGGGGG + Intergenic
1005837899 6:29721635-29721657 CTGAGGGATGAGAGGGACGGAGG + Intergenic
1005851498 6:29826584-29826606 CTGAGGGATGAGAGGGACGGAGG + Intergenic
1006457584 6:34140813-34140835 TTGAGGGGACAGGAAGAGGGAGG - Intronic
1006889945 6:37418168-37418190 CTGGAGGAAGAGGGGGACGGAGG + Intergenic
1007166380 6:39831743-39831765 CTGTGGGGACAGGAGCACTGGGG + Intronic
1007166481 6:39832081-39832103 CTGGGGGAACAGGTGTACTGGGG + Intronic
1007424469 6:41737731-41737753 CTGAGGATATAGGAGGAAGGTGG + Exonic
1008018703 6:46551103-46551125 CTGAGGGAAGATGAGGAGTGAGG + Intronic
1010259012 6:73794268-73794290 CTGAGGAACAAGGTGGACGGTGG - Intronic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1012143837 6:95656717-95656739 CTCAGGAAAAAGGAGGAAGGTGG - Intergenic
1012144049 6:95659144-95659166 GTGAGGGGACAGGAGGAGGGGGG + Intergenic
1014785650 6:125615711-125615733 AAGAGGGAACAGGAAGATGGTGG - Intergenic
1015181238 6:130365296-130365318 CAGAGGGAACTGAAGCACGGGGG - Intronic
1016053543 6:139554921-139554943 CTGAGGGTAGAGGAGAATGGGGG - Intergenic
1016461911 6:144286469-144286491 CTGAGGGGACAGGAGGAGGGGGG + Intronic
1017743520 6:157427168-157427190 CTGGGAGCACAGGAGGAAGGAGG + Intronic
1018258867 6:161949789-161949811 CTGTGGAATCAGGAGGACAGAGG - Intronic
1018287289 6:162254579-162254601 CTAAGTGAGCAGGAAGACGGTGG - Intronic
1018650193 6:165986581-165986603 TTGAAGGAAAAGGAGGAAGGAGG - Intronic
1018857057 6:167682284-167682306 CCCAGGGATCAGGAAGACGGCGG - Intergenic
1019904761 7:4053405-4053427 AGAAGGGAACAGGATGACGGAGG - Intronic
1020133785 7:5574683-5574705 CTAAGGGAAGAGAAGGAAGGAGG + Intergenic
1024019550 7:45353361-45353383 GGGAGGGAAGAGGAGGAAGGGGG + Intergenic
1025198674 7:56949335-56949357 TTGAGGGAGGAGGAGGAAGGAGG - Intergenic
1025673274 7:63627596-63627618 TTGAGGGAGGAGGAGGAAGGAGG + Intergenic
1025853858 7:65262215-65262237 CGGAGGGAAAAGGAGCATGGAGG + Intergenic
1026185648 7:68080843-68080865 CTGTGAGAACAGGAGAACGTGGG + Intergenic
1027624793 7:80532277-80532299 CTCTGGGGACTGGAGGACGGTGG - Intronic
1028101782 7:86829588-86829610 CTCAGGGAATAGGAGGCCTGAGG + Intronic
1028529167 7:91819138-91819160 CTGGGGGAAAAGGTGGAGGGAGG - Intronic
1029438402 7:100574786-100574808 GGGAGGGCACAGGAGGAAGGGGG + Exonic
1029607750 7:101609307-101609329 CTGAGAGGCCAGGAGGAAGGAGG - Intergenic
1029709677 7:102292857-102292879 GTGAGGGTGCAGGAGGAAGGGGG + Intronic
1030667841 7:112300797-112300819 CTGAGTGACCAGGAGAATGGTGG - Intronic
1031586689 7:123539020-123539042 CTGAGGGAAAAGGAGGGGGAGGG + Exonic
1031727567 7:125259710-125259732 ATGAGGGAACAGGATGGCTGAGG - Intergenic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1032316573 7:130843757-130843779 CTGAGGGACAAAGAGGAAGGAGG - Intergenic
1033929248 7:146503859-146503881 CTGAGGGGACAGGTGGCAGGTGG + Intronic
1034152153 7:148925478-148925500 GAGAGGCAACATGAGGACGGGGG + Intergenic
1035027275 7:155834220-155834242 CTGGGGGGATGGGAGGACGGGGG + Intergenic
1035109656 7:156470655-156470677 CTGAGGGCACTGGAGGCCGCCGG - Intergenic
1036663902 8:10726417-10726439 CTGGGGGAGAAGGAGGACAGGGG - Exonic
1037007946 8:13805620-13805642 GGGAGAGAACAGGAGGACAGAGG - Intergenic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1037587732 8:20289520-20289542 TTGAGGGACCAGGAGGTGGGTGG - Intronic
1037833305 8:22201566-22201588 CTGTGGGGAGAGGAGGATGGGGG - Intronic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1039419049 8:37420368-37420390 CTGCGGGGACAGGAGGCGGGGGG - Intergenic
1039575725 8:38622528-38622550 ATCAGGGACCATGAGGACGGTGG - Intergenic
1040879718 8:52191869-52191891 ATCAGGGAACAGGAGGTCTGAGG + Intronic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1043365069 8:79522828-79522850 AGGAGGGAAGAGGAGCACGGTGG + Intergenic
1044258727 8:90094326-90094348 CTGAGGGGACAGGCGGAGGGGGG + Intronic
1047355540 8:124118314-124118336 TTGAGGGAACAGGAAGAGGGAGG + Intronic
1047713893 8:127577865-127577887 CTGAGGGATCAAGAGGGCTGGGG + Intergenic
1049058576 8:140258215-140258237 CTGAGGGAGCAGGAGGGCTTGGG + Intronic
1049272259 8:141702298-141702320 CTGAGGGAACCTGAGGCCTGTGG + Intergenic
1049418694 8:142507286-142507308 CTGTGGAGCCAGGAGGACGGAGG + Intronic
1049641954 8:143719844-143719866 CTGAGGGAAGAGGTGGAGGAAGG + Intronic
1050022068 9:1294539-1294561 CTGAGGCAACAGGGGCAGGGTGG - Intergenic
1050339340 9:4620259-4620281 ATGAGGCCACAGGAGGAAGGAGG - Intronic
1050766499 9:9141233-9141255 CTGAGGGGAGAGGAAGACGGGGG - Intronic
1053603223 9:39631464-39631486 CTGACGGAAGAGGAAGATGGGGG + Intergenic
1054250313 9:62710961-62710983 CTGACGGAAGAGGAAGATGGGGG - Intergenic
1054564421 9:66745489-66745511 CTGACGGAAGAGGAAGATGGGGG - Intergenic
1054770442 9:69078435-69078457 CTGAGAGAAAAGGAGGAAGGTGG - Intronic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1056043208 9:82688891-82688913 CTTAAGGAACAGGTGGCCGGGGG + Intergenic
1056251677 9:84754804-84754826 CAGATGGGACAGGAGGAAGGTGG + Intronic
1059296561 9:113275919-113275941 CTTAGGGATCAGGAAAACGGTGG - Intronic
1059346779 9:113634424-113634446 CTCAGGGGACAGGGGGACCGAGG + Intergenic
1059397972 9:114050700-114050722 AAGAGGGAAAAGGAGGACCGGGG - Exonic
1059665447 9:116442297-116442319 CTAAGGGAACAGGAGGAACATGG - Intronic
1060102195 9:120850524-120850546 CTGAAGGAACATGAGGACTTGGG - Intergenic
1060218476 9:121752322-121752344 CAGAGGGAACGGGAGGTCAGTGG - Intronic
1060732893 9:126049309-126049331 CTGAGGGGTCTGGAGGAGGGAGG + Intergenic
1060750471 9:126165279-126165301 CTGCAGGAACAGGAGGAAGTGGG - Intergenic
1061212842 9:129203518-129203540 CAGAGGGAACAGCATGAAGGAGG + Intergenic
1061330708 9:129890474-129890496 CTGTGGGAACAAGCAGACGGAGG + Exonic
1061595703 9:131627882-131627904 ACGATGGAACAGGAGGATGGTGG + Intronic
1061798174 9:133100560-133100582 CATGGGGAACAGAAGGACGGAGG - Intronic
1061926828 9:133810012-133810034 CTGTGGGTACAGGACCACGGGGG + Intronic
1203431706 Un_GL000195v1:95708-95730 CAGAGGAAAAAGGAGCACGGAGG - Intergenic
1203733647 Un_GL000216v2:114940-114962 CTAAAGGAAGAGGAGGAGGGGGG - Intergenic
1203746947 Un_GL000218v1:45180-45202 CTCAGGGAAGAGGAGGCCGGAGG - Intergenic
1203563160 Un_KI270744v1:74300-74322 CTCAGGGAAGAGGAGGCCGGAGG + Intergenic
1186598661 X:11011955-11011977 CTTAGGGAACAGGGGCAGGGAGG - Intergenic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1188947537 X:36325587-36325609 CTGAGGGAAGAGGATGAAGCAGG + Intronic
1189085029 X:38013876-38013898 TTGAGGGACTAGGAGGACTGAGG - Intronic
1189400951 X:40667972-40667994 CTGTGGGAAGAGGAGCACTGGGG + Intronic
1192215676 X:69156585-69156607 GGGAGGAAACAGGAGGAAGGGGG + Intergenic
1192319802 X:70081285-70081307 CTAAGGCAACAGGAGGATGGGGG + Intergenic
1193848690 X:86508029-86508051 CTGACAGAACAGGAGAAGGGTGG + Intronic
1197711872 X:129677574-129677596 CTAAGGAAACAGGAGGAAGAAGG + Intergenic
1197713470 X:129688862-129688884 CTGAGGGAAGAGCAGGAAGTAGG - Intergenic
1199649983 X:149940498-149940520 CTGAGGGAGGAGGAGCAGGGGGG + Intergenic
1200253107 X:154564278-154564300 CAGAGGGAAGGGGAGGATGGAGG - Intronic
1200264660 X:154640137-154640159 CAGAGGGAAGGGGAGGATGGAGG + Intergenic
1201160272 Y:11160194-11160216 CTCAGGGAAGAGGATGCCGGAGG - Intergenic