ID: 1184097472

View in Genome Browser
Species Human (GRCh38)
Location 22:42324232-42324254
Sequence ATGGTGGTGGCCATTATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184097472 Original CRISPR ATGGTGGTGGCCATTATTAT TGG Intronic
904065240 1:27744790-27744812 GTGGTGGTGGCCATTATAACAGG + Exonic
905485797 1:38295422-38295444 ATGGTTGTGGCCATCTTTTTTGG + Intergenic
907780209 1:57559761-57559783 AGGGTGAGGGCCATTATGATGGG + Intronic
911371426 1:96998963-96998985 CTGATGGTGGCCATTTTTAGAGG + Intergenic
912781283 1:112551045-112551067 ACTGTTGTGGCCATTACTATTGG + Intronic
915225267 1:154406786-154406808 ATGGTTGTGGTCCTTATGATTGG + Intronic
915799710 1:158777217-158777239 AGTGTGGTGGTCATAATTATAGG + Exonic
919248279 1:195017042-195017064 AGGGTGGTGTCCATAATGATGGG - Intergenic
919669732 1:200327788-200327810 ATGGTGGTGGAGATGATTAATGG - Intergenic
923448971 1:234098539-234098561 ATGGTGGTGGTGATTATTGGTGG + Intronic
923511727 1:234659038-234659060 GTGGTGGTGGCCACATTTATTGG + Intergenic
923631787 1:235654260-235654282 AGGCTCGTAGCCATTATTATAGG + Intergenic
1062765772 10:63912-63934 TTGTTGGTGCCCATTATTTTTGG + Intergenic
1063493864 10:6489340-6489362 ATGGTGGTGGCCTTTCTTCGCGG - Intronic
1063819754 10:9820301-9820323 TTGGTGGTGTCCATACTTATTGG - Intergenic
1065047820 10:21759549-21759571 AAGGTGGTGGCCGTTTTGATGGG + Exonic
1066094416 10:32058598-32058620 AAGATGGTGGCCATTGGTATTGG - Intergenic
1066467674 10:35667662-35667684 ATGGTGGTGGTGATGATGATGGG - Intergenic
1068295285 10:55062914-55062936 ATGATAGTGGCCAATATTTTTGG + Intronic
1070509019 10:77142579-77142601 ATGGTGATGGCAATTTTTTTAGG + Intronic
1071413336 10:85418502-85418524 ATGGCTTTGGCCATGATTATTGG + Intergenic
1077417039 11:2428930-2428952 ATGGTGGTGGTAATAATCATGGG + Intergenic
1078162186 11:8850507-8850529 TTGGTGGTAGCCATTCTAATAGG - Intronic
1078806430 11:14710308-14710330 ATTGTGATTGCCATTATTTTTGG + Intronic
1079387184 11:19990720-19990742 ATAGTGGTGGCCATTATAGTAGG - Intronic
1080419430 11:32096828-32096850 CTGGTGATGGCCATTATCAACGG - Intronic
1081655794 11:44856591-44856613 AAGGTGCTGTTCATTATTATGGG - Intronic
1082141102 11:48610489-48610511 TTGGTGGTGGCCATGATTGGAGG + Intergenic
1082568260 11:54707311-54707333 TTGGTGGTGGCCATGATTGGAGG + Exonic
1082614627 11:55343627-55343649 TTGGTGGTGGCCATGATTGGAGG + Exonic
1090367426 11:126218713-126218735 TGGGTGGTGGCCATTACTATAGG + Intronic
1091721569 12:2817757-2817779 ATGGTGATGGTCTTTATTAACGG - Intronic
1092233419 12:6790878-6790900 CTTGTGGTGGACATTTTTATCGG + Intronic
1092319004 12:7451511-7451533 ATGGAGGTGGCCCTTATTCTAGG + Intronic
1093736584 12:22626079-22626101 ATGGTCGTGGTCATTACTTTGGG - Intronic
1100064557 12:90626261-90626283 ATGGGAGTTGCCAGTATTATGGG + Intergenic
1101004057 12:100384590-100384612 ATGGTAGTGGGGATTATTGTAGG + Intronic
1101871988 12:108573282-108573304 ATGGTGGTTCTCATTATTACAGG + Intergenic
1101872623 12:108578581-108578603 ATGGTGGTGGTGATGATAATGGG - Intergenic
1104863934 12:131941645-131941667 CTGGTGGTGGCCATTGTGAAGGG + Exonic
1108094908 13:46891479-46891501 ATTGTGTTGGCTCTTATTATTGG + Intronic
1112038468 13:95520109-95520131 ATGGTGGGGTCTATTATCATGGG - Intronic
1114733457 14:25018839-25018861 TTGGTGGTAGCTATTCTTATTGG - Intronic
1115055638 14:29122618-29122640 ATTGTGGTGGCTATTGTTTTTGG + Intergenic
1117005588 14:51418311-51418333 ATGTTGGTGACCATCATCATGGG + Intergenic
1119691277 14:76674647-76674669 GTGGTGGTGGCCGTTATTCAGGG - Intergenic
1126494832 15:49278646-49278668 ATGGTGGTGGTTAAGATTATGGG + Intronic
1127536477 15:59894379-59894401 ATAGTGGTAGCTATTATTTTAGG - Intergenic
1128894557 15:71360461-71360483 TTGATGGTGGCCATCTTTATAGG + Intronic
1130794376 15:87193400-87193422 TAGGAGGTGGCCCTTATTATAGG + Intergenic
1131069231 15:89454709-89454731 ATGGTTTTGACCATTATTATTGG - Intergenic
1134559239 16:15193699-15193721 GTGCTGGTGGCCATTTTTCTGGG + Intergenic
1134919776 16:18105312-18105334 GTGCTGGTGGCCATTTTTCTGGG + Intergenic
1136593821 16:31233140-31233162 TTGGTGCTGGCCATTTGTATAGG + Intergenic
1139006649 16:62579947-62579969 ATAGTGGTAGCCATTATTTTTGG + Intergenic
1140554743 16:75908975-75908997 ATGGTGGGGGCTATTACTATAGG + Intergenic
1141813650 16:86393923-86393945 ATGGTGGTGGTCATGATGATGGG - Intergenic
1144323848 17:14157952-14157974 ATAGTGGTGGTTATCATTATTGG + Intronic
1145725089 17:27113337-27113359 ATGGTCGTGGTCTTTAGTATAGG - Intergenic
1146563309 17:33890411-33890433 ATGTTGGTTTCCACTATTATTGG - Intronic
1151142509 17:72007470-72007492 ATGGTGGTGGTGATTTTTGTGGG + Intergenic
1151715140 17:75827467-75827489 AGGGTGGTGGCCATTACTAGAGG - Exonic
1153165342 18:2255477-2255499 TTGGTGTTGGCCATTTTTGTAGG - Intergenic
1158448079 18:57538460-57538482 ATGGAAGTAGCCATTATTACAGG + Intergenic
1158657032 18:59346828-59346850 ATGGTAGTGGTTATTATTAGAGG - Intronic
1158933560 18:62344572-62344594 AAAGTGGTAGCTATTATTATCGG - Intronic
1159280350 18:66276880-66276902 ATGTGGGTGGCCATTATCATAGG - Intergenic
1162183990 19:8890478-8890500 ATAGTGGTGGTGATGATTATGGG - Intronic
1164922675 19:32101180-32101202 CAGGTGGAGGCCATTATTCTAGG - Intergenic
1165298941 19:34955184-34955206 TTGGTGGTAGCCATTCTAATGGG - Intergenic
1168614983 19:57830282-57830304 CTGGTGGCGGCCATTTTGATTGG + Exonic
1168622283 19:57889027-57889049 CTGGTGGCGGCCATTTTGATTGG - Exonic
925479911 2:4259058-4259080 ATGGTTGTGGACATTTTTAGGGG - Intergenic
928829225 2:35459058-35459080 ATGGTGCTTGCCATTCTTCTGGG + Intergenic
933524271 2:83416152-83416174 CTGGTGGTGGCAATTGCTATGGG - Intergenic
936524365 2:113232887-113232909 GTGGTGGTGCCCATGATGATGGG - Intronic
936670940 2:114655167-114655189 ATGTTGGTTGCTATTATGATTGG + Intronic
937515282 2:122647643-122647665 CTGGTGGTGGCACTTATTAGTGG + Intergenic
938637538 2:133245779-133245801 ATGCTTGTGGCCAATATTTTAGG + Intronic
938942092 2:136178321-136178343 ATGGTGGTGACCCTTAAGATGGG - Intergenic
939159797 2:138574423-138574445 ATTGTGATGGTCATTATAATAGG + Intergenic
939808824 2:146807411-146807433 ATTGGGGTGGTTATTATTATTGG - Intergenic
942948330 2:181694542-181694564 GTGGTGGTGGCCATTATTGGTGG - Intergenic
943276591 2:185875899-185875921 ATGGTGGTGGCAACTGTTTTAGG - Intergenic
947020996 2:225675425-225675447 ATGCTGGAGGCCATTATCCTAGG - Intergenic
947302872 2:228707619-228707641 CTTATGATGGCCATTATTATAGG + Intergenic
948339266 2:237236076-237236098 TTTGTGGTGTCCATTTTTATAGG - Intergenic
948352299 2:237350934-237350956 ATGGTGGTGGGAATTATGGTGGG + Intronic
1170274378 20:14567556-14567578 ATGGTGATGACCATTTTGATTGG + Intronic
1170274576 20:14570326-14570348 ATGGTGGTTAGCATTATTGTTGG + Intronic
1176247824 20:64105651-64105673 ATGGGGGTGGGCATGATGATGGG + Intergenic
1184097472 22:42324232-42324254 ATGGTGGTGGCCATTATTATTGG + Intronic
1184384912 22:44168460-44168482 ATGGTGGTGGCCAGTCTTTAAGG + Intronic
1185015050 22:48338336-48338358 ATGGGGGTGGCCATGAGGATGGG + Intergenic
951059860 3:18192770-18192792 AAGGTGGTGGCCATCACAATAGG + Intronic
955507497 3:59646699-59646721 ATGTTGGTGGCCTTTATTGGTGG + Intergenic
960006147 3:112783116-112783138 TTGGTGGTGACCCTTATGATGGG + Intronic
960147752 3:114221180-114221202 GAAGTGTTGGCCATTATTATTGG + Intergenic
961790660 3:129374272-129374294 ATGATTTTGGCCATGATTATAGG - Intergenic
961849972 3:129806409-129806431 ATGGTGGTGGTAATTAGTCTGGG - Intronic
962279227 3:134037704-134037726 ATAATGGTGGCCATTATTGAGGG - Intronic
963745468 3:149120196-149120218 ATGGTGGTGTTCCTTATAATGGG + Intergenic
966256576 3:177923735-177923757 ATGGTGTTGAACATTATTAATGG - Intergenic
969143087 4:5096847-5096869 ATGGTGTTGGCCATTTTTAAAGG + Intronic
970525721 4:16929907-16929929 ATGGTGGTGAACATTCTTACAGG + Intergenic
972801476 4:42480175-42480197 CTGGTGGTGGTCATCATAATTGG + Intronic
975026804 4:69559130-69559152 GTGGTGGTGGCCATCATAAGAGG + Intergenic
976126114 4:81835400-81835422 CTGGTGGTGGCCATAATCCTTGG - Intronic
976563830 4:86531399-86531421 GTGGTGGTGGTCATTGTTATGGG + Intronic
977849686 4:101810873-101810895 ATTTTGGTAGCCTTTATTATAGG + Intronic
979912476 4:126385693-126385715 ATTGTTATAGCCATTATTATTGG + Intergenic
981351509 4:143734982-143735004 TTGATTGTGGCCATTCTTATAGG + Intergenic
988169326 5:27633903-27633925 ATGGTGACGGCTATTATGATGGG - Intergenic
995020688 5:107364154-107364176 TTGTTGGTGACAATTATTATTGG + Intergenic
995369176 5:111399358-111399380 GTAGTGGTGGTTATTATTATAGG - Intronic
997799365 5:136844172-136844194 ATTGTGGTGGCAAATATTGTGGG - Intergenic
997897486 5:137732721-137732743 ATGGTAGTTGCTATTATCATTGG - Intronic
1001703820 5:173727397-173727419 AAGCTGGAGGCCATTATTGTAGG + Intergenic
1007952205 6:45882387-45882409 AGGGTGGTGGCCATTGCCATTGG - Intergenic
1008045196 6:46844676-46844698 ATGTTGGTGACCATTTTTGTTGG - Intergenic
1008873151 6:56296735-56296757 ATGTTGGTGGTTAGTATTATAGG - Intronic
1014291144 6:119560303-119560325 AATGTGGTGGCCTGTATTATGGG - Intergenic
1015784952 6:136913183-136913205 AAGGTGGGGGACATTCTTATAGG + Intronic
1024015559 7:45311476-45311498 ATGGTGGTGGTGGTTATAATGGG + Intergenic
1027601454 7:80245854-80245876 ATGGTGATGCCCATTCTCATAGG + Intergenic
1028688492 7:93621352-93621374 ATAATGGTGGCCATTTTTATTGG + Intronic
1030712653 7:112769111-112769133 CTGGTGGTGTCCATTTTTAATGG - Intronic
1031719875 7:125160548-125160570 ATGGTGGTGCTCATCATTTTGGG + Intergenic
1032165470 7:129541484-129541506 ATGATGGAGGCCATATTTATGGG + Intergenic
1036428883 8:8671184-8671206 ACGATGATTGCCATTATTATTGG - Intergenic
1038239521 8:25795847-25795869 ATGATGGAGGCCAATATTCTAGG + Intergenic
1039038377 8:33383898-33383920 GTGGTGGTGGGGATTATGATGGG - Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043839379 8:85084428-85084450 ATGGTGGTGGGCAGTTTTGTGGG - Intergenic
1046796150 8:118374659-118374681 TTGGTAGTGGCCATTCTAATGGG + Intronic
1048489133 8:134875871-134875893 ATGGTGTTGGCCATTGTTTCTGG + Intergenic
1049107628 8:140623697-140623719 ATGATGGTGGCCATTATGGAGGG - Intronic
1050621112 9:7452952-7452974 ATGATGATGGCTATTATTTTAGG + Intergenic
1050741541 9:8826180-8826202 ATGGTGGTGGCAATGACTACAGG - Intronic
1051058694 9:13020059-13020081 TTGGTTGTGGCAATGATTATTGG - Intergenic
1051184744 9:14448335-14448357 ATAGTGGTAGGCATAATTATTGG + Intergenic
1052462267 9:28780752-28780774 ATGTTTGTGTGCATTATTATTGG - Intergenic
1052747345 9:32453393-32453415 ACAGTGGTGGCCATGACTATGGG + Exonic
1053333275 9:37236223-37236245 ATGATACTGGCCATTCTTATAGG + Intronic
1053652369 9:40182063-40182085 ATGTTGGTGACCATTTTTGTTGG + Intergenic
1053902767 9:42811375-42811397 ATGTTGGTGACCATTTTTGTTGG + Intergenic
1054532213 9:66194152-66194174 ATGTTGGTGACCATTTTTGTTGG - Intergenic
1055398560 9:75899015-75899037 ATTGTGTTGGCAATGATTATTGG + Intronic
1058243938 9:102601492-102601514 ATTTTGGTTGGCATTATTATAGG - Intergenic
1062739475 9:138160357-138160379 TTGTTGGTGCCCATTATTTTTGG - Intergenic
1187795531 X:22999939-22999961 ATGGCGGTGGCAATTATTTCCGG - Exonic
1188140974 X:26550573-26550595 AGTGTGGTGGCTGTTATTATTGG - Intergenic
1191045672 X:56134118-56134140 ATAGTGGTGGCATTTTTTATGGG - Intergenic
1193230073 X:79033454-79033476 AAGGTGGTTGGCATTTTTATTGG + Intergenic
1194541667 X:95179961-95179983 ATCCTGGCGGCCATCATTATGGG + Intergenic
1196789320 X:119449828-119449850 ATGGTGGTAGCCTGAATTATGGG + Intronic
1202098870 Y:21284521-21284543 AGGGAGGTGGGCATTATTAATGG - Intergenic
1202275012 Y:23108659-23108681 ATGGTAGTTGCCATTTCTATTGG - Intergenic
1202291016 Y:23312030-23312052 ATGGTAGTTGCCATTTCTATTGG + Intergenic
1202428003 Y:24742381-24742403 ATGGTAGTTGCCATTTCTATTGG - Intergenic
1202442788 Y:24927710-24927732 ATGGTAGTTGCCATTTCTATTGG + Intergenic