ID: 1184098196

View in Genome Browser
Species Human (GRCh38)
Location 22:42327973-42327995
Sequence GAGGGGGCCCAGAGCTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184098196 Original CRISPR GAGGGGGCCCAGAGCTATGA TGG (reversed) Intronic
900259105 1:1714555-1714577 GGGGTGGCCATGAGCTATGAGGG - Intronic
900519569 1:3099045-3099067 GAGGGGACCCAGAGCGGTGGGGG + Intronic
900888510 1:5432335-5432357 GAGTGGGTCCAGAGCAAGGAAGG - Intergenic
901065223 1:6491071-6491093 GAGGGGGCCCAGAGAAAAGCGGG - Intronic
901318657 1:8325491-8325513 GTGCGGGCCCAGAGCTATCTGGG - Intronic
901493188 1:9607044-9607066 GAGGGTGCCCAGAGCCGTGCTGG + Intronic
903907445 1:26696626-26696648 GACGGGGCCGAGAGCAATGGGGG + Exonic
904306270 1:29592285-29592307 GAGGGGGGCCATGGCTATGACGG - Intergenic
905541338 1:38762886-38762908 GATGAGGCCCAGTGCTATGGAGG - Intergenic
906884887 1:49633592-49633614 GAGGCTGCAGAGAGCTATGATGG + Intronic
909240956 1:73212678-73212700 GTGTGGTCCCAGAGCTAGGAGGG - Intergenic
913374258 1:118133285-118133307 GAGGGGGCCCAGAGTGCAGATGG + Intronic
915108270 1:153547528-153547550 TAGGAGGCCCAGAGATGTGAGGG - Exonic
915896047 1:159811755-159811777 GAGGATGCCCAGAGCTATTGGGG + Intronic
915951187 1:160190769-160190791 GATGGGGCCCAGAGCTGTGCCGG + Exonic
918071663 1:181137679-181137701 GAAGGAGCCCAGAGCCAGGAAGG - Intergenic
920697613 1:208193290-208193312 AAGGGGCCCTAGGGCTATGAGGG - Intronic
920979876 1:210823121-210823143 GAGGTGGCCCAGAGTTACCATGG - Intronic
923514441 1:234682488-234682510 GAGGAGCCCCAGAGCTCTGTAGG - Intergenic
1063274804 10:4554013-4554035 GAGGCTGCCATGAGCTATGATGG - Intergenic
1064720663 10:18225702-18225724 GAGGTTGCCGTGAGCTATGATGG - Intronic
1066428058 10:35326822-35326844 GAGGCTGCACTGAGCTATGATGG + Intronic
1066617208 10:37307620-37307642 GAAGGGGCTCAGAGGTAGGAGGG + Intronic
1069409063 10:68133666-68133688 GAGGGGGCCCAGGGCAGTCAGGG + Intronic
1069847720 10:71384342-71384364 GAGGTGACCCAGAGCTGGGAGGG + Intergenic
1070749430 10:78955251-78955273 GAGAGGGCCAAGAGCAATGGTGG + Intergenic
1072193189 10:93092840-93092862 GAGATGGCCCAGAACTGTGAAGG - Intergenic
1072948624 10:99833452-99833474 GAGGTGGCTCAGACCTATTAAGG + Intronic
1075714555 10:124548532-124548554 GTGGGGGCCCCGAGGTAGGAGGG - Intronic
1075808914 10:125210170-125210192 GAGGGGGCTCAGAGTGATCATGG + Intergenic
1077545940 11:3169847-3169869 GTGCGGGCCCAGAGCTGGGAAGG - Intergenic
1078381153 11:10841962-10841984 GAGGTGGCAGTGAGCTATGAAGG + Intronic
1079454823 11:20627091-20627113 GAGTTGGCCCAAAGCTATTAAGG - Intronic
1082794726 11:57370802-57370824 GAGGGGGCCCAGATGTGTGTGGG - Intergenic
1083427955 11:62598794-62598816 GATGGGGCATAGAGCTAAGAAGG - Intronic
1083844990 11:65326453-65326475 GAGGGGCCCCACAGGTAAGAAGG - Intergenic
1083864253 11:65445214-65445236 GAGGGGGCCCACAGGTGAGAAGG - Intergenic
1084782596 11:71420257-71420279 GAAGGGGCTGAGTGCTATGAGGG - Intergenic
1086592061 11:88526472-88526494 GCAGGGGCCCAGAGCTCTTAAGG + Intronic
1087127614 11:94642610-94642632 GATGGGGCGCAGAGATATAAGGG - Intergenic
1088699266 11:112397529-112397551 GAGGGGGCCTAGAGGTAGGGTGG + Intergenic
1089402306 11:118171404-118171426 GCAGAGGCCCAGAGCTCTGAGGG + Intronic
1090194237 11:124800730-124800752 GAGGGGGCCCGGAGTTAAGGAGG + Intergenic
1094306069 12:29020597-29020619 GAGAGGGCACTGAGCTATGGGGG - Intergenic
1094404428 12:30100184-30100206 AAGGCTGCTCAGAGCTATGATGG - Intergenic
1095665106 12:44788567-44788589 GAGGGTGCCCAGAGGCATGGGGG + Intronic
1096879003 12:54652380-54652402 GAGGGTGCAGTGAGCTATGATGG - Intergenic
1100657336 12:96660987-96661009 GAAGGGGCACAGAGCTTTCATGG + Intronic
1101988749 12:109467555-109467577 GAGGCTGCCGTGAGCTATGATGG + Intronic
1102472664 12:113168276-113168298 GAGGGGGCCCGGAGCTCTGAGGG + Intronic
1102912857 12:116731683-116731705 GAGGCTGCAAAGAGCTATGACGG + Intronic
1102931220 12:116863761-116863783 GAGGGTGCAGTGAGCTATGATGG - Intronic
1103174766 12:118853285-118853307 GAGGGGGACCTGACCTATGTTGG + Intergenic
1103435719 12:120923865-120923887 GAGGGGCCTCAGAGCTGGGAAGG + Intergenic
1103617893 12:122166608-122166630 CATGGGGCCCAGAGCTCAGAGGG - Intergenic
1104003531 12:124875676-124875698 GAGGGGGCCCAGGGCTCAGAGGG - Intronic
1104470068 12:129022816-129022838 GAGAGAGCCCAGAGCACTGAGGG - Intergenic
1104957039 12:132472018-132472040 GAGGTGGCGCAGAGCCCTGAGGG + Intergenic
1104984349 12:132588093-132588115 GAGGGGGCACACAGCTCAGAAGG + Intergenic
1106026432 13:25960084-25960106 GAAGGGGCCCAGAGGCAGGAGGG + Intronic
1106637998 13:31551735-31551757 CAGGGGGCCCAGTCCTAAGAGGG - Intergenic
1110344013 13:74425097-74425119 GAGGGGGCAGTGAGCAATGATGG - Intergenic
1112281954 13:98070642-98070664 GAGGCTGCCATGAGCTATGATGG + Intergenic
1113654093 13:112057387-112057409 GAGGGGGCGCGGAGCTGTGGCGG - Intergenic
1114400839 14:22408973-22408995 GAGCTGGCTCAGACCTATGAAGG - Intergenic
1116176629 14:41479119-41479141 GAAGGGGCACAGAGCTCTCAAGG - Intergenic
1118540151 14:66814253-66814275 GAAGGCACCCAGATCTATGATGG + Intronic
1119507309 14:75184034-75184056 GAGGCAGCACTGAGCTATGATGG - Intergenic
1120206381 14:81591369-81591391 CTTGGGGCCCAGAGCTCTGAAGG + Intergenic
1122330823 14:100911272-100911294 GAGGGGGCTCAGAGGTGGGATGG + Intergenic
1122421026 14:101577507-101577529 CTGGGGGCCCAGAGCCCTGATGG + Intergenic
1122803834 14:104246890-104246912 GAGGTGGCCCAGAGCTGGGCGGG + Intergenic
1123113015 14:105881842-105881864 GGGGGAGCTCAGAGCCATGAAGG - Intergenic
1123119614 14:105910709-105910731 GGGGGAGCTCAGAGCCATGAAGG - Intergenic
1123407283 15:20028673-20028695 GAGGTTGCACTGAGCTATGATGG - Intergenic
1123516610 15:21035329-21035351 GAGGTTGCACTGAGCTATGATGG - Intergenic
1124742625 15:32312917-32312939 GAGTGGGCGCAGGGCGATGAGGG + Intergenic
1126440569 15:48683761-48683783 GAGGGGGCCCACTGCCATGAAGG + Intergenic
1128752521 15:70159478-70159500 AATGGGGCCCAGAGAGATGAAGG + Intergenic
1129254673 15:74327288-74327310 GCTGGGGCCCAGAGCGAGGAAGG - Intronic
1130410558 15:83644741-83644763 GAGGGGGCACACAGAGATGATGG - Intergenic
1130461425 15:84160213-84160235 GAGGAGGGCTAGAGCTCTGAGGG - Intergenic
1132665090 16:1077923-1077945 GAGGGGGCTCAAAGCTCCGATGG + Intergenic
1134407077 16:13970046-13970068 AAGGGAACCCAGTGCTATGAAGG - Intergenic
1135510123 16:23075301-23075323 GAGTGGGAGCAGAGCTGTGAGGG + Intronic
1136406936 16:30053513-30053535 GAGGGGGCCCAGAGAGGGGAAGG - Intronic
1137270606 16:46900256-46900278 GAGGGGGCCTAGGGCGTTGAGGG + Intronic
1137367152 16:47870518-47870540 GAGGGGTCTCAGAGCCAAGATGG + Intergenic
1137758395 16:50920447-50920469 GAAGGGGCCCAGAGCCGAGAGGG + Intergenic
1138014312 16:53414698-53414720 GAGGTGGCAGTGAGCTATGATGG + Intergenic
1138125858 16:54437797-54437819 GAGTGGGGCCAGAGCTGTCAGGG + Intergenic
1138896132 16:61206900-61206922 GACATGGCCCAGAGCCATGAGGG + Intergenic
1139369566 16:66458408-66458430 GAGGGGGCCAAAAACTATGAGGG - Intronic
1139437520 16:66944899-66944921 GAGGGGGCCCAGGGCTCAGTGGG - Exonic
1141177806 16:81732313-81732335 GAGGGTGCGGTGAGCTATGATGG - Intergenic
1141444127 16:84047257-84047279 GAGGGGACCCTGAGCTATCCAGG + Intergenic
1142281030 16:89147536-89147558 GAGGGGCCACAGAGCGAGGAGGG + Intronic
1144047806 17:11469328-11469350 GAAGGGGCCAAGAGCCAAGAAGG + Intronic
1144218759 17:13081095-13081117 GAGGCTGCAGAGAGCTATGATGG + Intergenic
1144727414 17:17508788-17508810 GAGGGGGCCCCGTGCCATGAGGG - Intronic
1147306637 17:39568751-39568773 GTGGGGGCTCAGAGGCATGAAGG - Intergenic
1147611822 17:41806417-41806439 GAAGGGGCCCAGGGCTGAGATGG + Intronic
1148778513 17:50109158-50109180 CAGGGGTCCCAGAGCTGGGAGGG - Intronic
1150646089 17:66978392-66978414 GAGGGGACCCAGAGTGAAGATGG + Intronic
1151401366 17:73857996-73858018 GAGGGGGCCCTGAGGGAGGAGGG - Intergenic
1151626375 17:75278395-75278417 GCGAGGGGACAGAGCTATGATGG - Intronic
1151703786 17:75756518-75756540 GTGCGGGCCCAGAGCCAGGAAGG + Exonic
1151708300 17:75784507-75784529 GAAGGGGCCCAGAGCTAGGGAGG - Intronic
1151933577 17:77247987-77248009 AAGGGGGCTGAGAGCTATGGAGG + Intergenic
1152630659 17:81409430-81409452 GAGGCAGCCCACAGCTGTGAAGG + Intronic
1152930219 17:83105512-83105534 GAGGTGTCCCAGAGCCAGGAGGG - Intergenic
1153911803 18:9711247-9711269 GAGGGTGCAGTGAGCTATGATGG - Intronic
1154173571 18:12067675-12067697 GTGGGGCCCCAGAGCTATGGAGG - Intergenic
1154314891 18:13296878-13296900 GAGGAGGCCGTGAGCTTTGAGGG + Intronic
1155750146 18:29412678-29412700 GAGGCTGCCGTGAGCTATGATGG - Intergenic
1157223942 18:45846190-45846212 CAGGGGGCCCAGAAACATGAGGG - Intergenic
1157408503 18:47444135-47444157 GAAGGGGCCTAGAGATATGATGG - Intergenic
1157573663 18:48730180-48730202 GAGGGGCCCCCGAGGTGTGAGGG + Intronic
1157573701 18:48730288-48730310 GAGGGGCCCCTGAGGTGTGAGGG + Intronic
1160770487 19:828724-828746 GAGGGGGCCCAGAGAAAGGAAGG + Intronic
1160933144 19:1580214-1580236 GAGGGGGCCCAGAGGTACCACGG + Intronic
1161355148 19:3814883-3814905 CAGGAGGCCCAGAGCAAGGAGGG - Intronic
1161815945 19:6500191-6500213 GAGGCTGCCATGAGCTATGATGG - Intronic
1162524931 19:11201604-11201626 GAGGGAGCCCAGATCTAGGAAGG - Intronic
1163096130 19:15058506-15058528 GAGGGTGCAGTGAGCTATGATGG - Intergenic
1163483349 19:17571906-17571928 GAGGCTGCCATGAGCTATGATGG - Intronic
1164468923 19:28512177-28512199 GAGTGGGCCCAGAGCAGTAAAGG + Intergenic
1164540604 19:29119019-29119041 GAGGAGGCCCAGAGAAAGGATGG - Intergenic
1165748128 19:38242875-38242897 GAGGGTGCAGTGAGCTATGATGG + Intergenic
1166193844 19:41193654-41193676 GTGGGGGACCAGGGCTAGGAGGG + Intronic
1166380397 19:42352526-42352548 GAGGGGACCCAGCGCCATGATGG - Intronic
1167595130 19:50423503-50423525 GAGGGAGACCAGAGCCAGGAGGG + Intronic
1168096294 19:54117028-54117050 GAGGCTGCCGTGAGCTATGATGG + Intronic
1168705634 19:58468792-58468814 GAGGGGTCCCAGACATGTGAGGG + Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
933659464 2:84915809-84915831 GGGGGGGCCCAGAGCCCTGGTGG + Intergenic
933937088 2:87215295-87215317 GAGGGGGCACAGAGGTATCTGGG - Intergenic
935218218 2:100990991-100991013 GAGTGTGCCCACAGCTGTGAAGG + Intronic
935531739 2:104240845-104240867 GAGGTTGCACTGAGCTATGATGG + Intergenic
935830588 2:106997471-106997493 GAGGGAGATCAGAGCTGTGATGG + Intergenic
936094899 2:109523997-109524019 GAGGTGGCCCAGGACTCTGAAGG - Intergenic
936356053 2:111750529-111750551 GAGGGGGCACAGAGGTATCTGGG + Intergenic
937115841 2:119404451-119404473 GAGGCAGCACAGAGCTATGGGGG - Intergenic
937214594 2:120303611-120303633 GAAGAGGCACAGAGCGATGAGGG - Intergenic
937423877 2:121781158-121781180 GAGGCTGCAGAGAGCTATGATGG + Intergenic
937513624 2:122628020-122628042 GGAGGAGCCCAGAGCTATGATGG + Intergenic
939619749 2:144404252-144404274 GAGGGGGCCGGGTGCAATGATGG - Intronic
941888708 2:170555805-170555827 GAGGGTGCAGTGAGCTATGATGG + Intronic
946886311 2:224226345-224226367 GATGGGGCACAGAGATATAAGGG - Intergenic
946902791 2:224388854-224388876 GAGTGAGCCCAGAGCTCTGGAGG + Intronic
946943823 2:224798694-224798716 GAGGCTGCCGTGAGCTATGATGG - Intronic
947214802 2:227740284-227740306 GAGGGTGCAGCGAGCTATGATGG + Intergenic
947664414 2:231894683-231894705 GAGGGTGCCCAGAGCTGACATGG - Intergenic
948263478 2:236621318-236621340 GAGGGGGAGCAGAACTCTGATGG + Intergenic
948925741 2:241095954-241095976 GAAAGGGCCCAGAGATATCAAGG - Exonic
1169181292 20:3570004-3570026 GAGGTTGCACTGAGCTATGATGG + Intronic
1170418428 20:16168912-16168934 AAGGAGGCCGAGAGCTATCAAGG + Intergenic
1170934620 20:20798866-20798888 GAGGCTGCCCTGAGCTATGATGG + Intergenic
1172026569 20:31952767-31952789 GAGGCTGCCCTGAGCTATGATGG + Intergenic
1172184017 20:33020281-33020303 CAGAGGGCACAGAGCCATGAGGG - Intronic
1172634588 20:36401387-36401409 GAGGGGGCTCTGAGCTGAGAGGG + Intronic
1173578098 20:44126215-44126237 GAGGGGGCACAGTGTTTTGAAGG + Intronic
1173620935 20:44435397-44435419 GAGGTTGCAGAGAGCTATGATGG - Intergenic
1174784263 20:53418071-53418093 GAGGGGACCCTTAGCTAGGATGG + Intronic
1175579377 20:60087337-60087359 GAGGGTGCCCACAGCAAGGAAGG - Intergenic
1176084501 20:63289895-63289917 GAGGGGGCCAGGAGCAGTGAGGG - Intergenic
1176694018 21:9951931-9951953 GAGGCTGCCATGAGCTATGATGG - Intergenic
1179233690 21:39527063-39527085 GAGGGAGCCCTGAGGTAAGAGGG - Intergenic
1179921396 21:44509489-44509511 GAGGGGGCGCAGAGGTGTGGGGG + Intronic
1180197946 21:46208601-46208623 GAGGGGGCCCAGGTCTCTGCGGG + Intronic
1181464816 22:23105229-23105251 AAGGGGGCCCAGAGCCTCGAAGG + Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1183591526 22:38781870-38781892 GTGGAGGCCCAGAGCGATGAGGG - Intronic
1183632681 22:39042833-39042855 GGGGAGGCCCAGAGCCATGCAGG + Intronic
1184098196 22:42327973-42327995 GAGGGGGCCCAGAGCTATGATGG - Intronic
1184596267 22:45516087-45516109 GAGGGGCACCCGAGCTATGCAGG + Intronic
1184949854 22:47833497-47833519 GAGGAGGGCCACAGCTGTGAAGG + Intergenic
952341402 3:32450628-32450650 GAGGGGGCAGAGAGGTGTGATGG - Intronic
952669419 3:35948194-35948216 AATGGGGTCCAGATCTATGAGGG + Intergenic
953571906 3:44077947-44077969 GGGAGGGCCCAGAGCGAGGAGGG - Intergenic
953880448 3:46688595-46688617 GAGGAGGCCCAGAGCCAGGGGGG - Intronic
958906490 3:99947502-99947524 GAAGGGACCCAGAGCTAAAAAGG + Intronic
960044254 3:113180768-113180790 GAGGGGCCCCAGGGCTTTGAAGG - Intergenic
960914193 3:122680584-122680606 TAGGGGGCCCGGAGTTAGGAGGG + Intergenic
960964171 3:123092943-123092965 GAGGGGGCCCAGGCCTATAAAGG + Intronic
961372268 3:126438831-126438853 GATGTGGCCCAGGGCTATGGAGG + Intronic
961434758 3:126909298-126909320 CATGGGGCCCAGAGGTCTGAGGG - Intronic
962285051 3:134078269-134078291 GAAGGAGTCCAGAGCTTTGAAGG + Intronic
962314538 3:134350919-134350941 GAGGGAGCCCAGGGCTGTCAGGG + Intergenic
962878203 3:139552233-139552255 GAGGGGGACCAGAGTTAGGAGGG + Intergenic
963077434 3:141360229-141360251 GTGGGGTCCCAGAGCTAAGATGG - Intronic
964516286 3:157512151-157512173 GAGGGGAGCAAGAGCTGTGAGGG + Intronic
965693336 3:171380865-171380887 GAGATGGCCCAGAGCCATGTAGG + Intronic
967413418 3:189190489-189190511 GAGGCTGCCCAGAGATTTGAGGG - Intronic
968066066 3:195760465-195760487 GAAGGGGTCCAGCGCTAGGATGG + Intronic
968066090 3:195760540-195760562 GAAGGGGTCCAGCGCTAGGATGG + Intronic
972581599 4:40400090-40400112 GAGGGGGTGCAGAGCTCTGATGG + Intergenic
973935267 4:55840038-55840060 GAGGGTGCAGTGAGCTATGATGG + Intergenic
975335490 4:73170632-73170654 GAGGGGGCCCACTGTTCTGAAGG + Intronic
976162601 4:82219499-82219521 GAGGCTGCCGTGAGCTATGATGG - Intergenic
980366641 4:131812124-131812146 GAGGCTGCCATGAGCTATGATGG - Intergenic
983165939 4:164477450-164477472 GAGGGAGCCCACTGCCATGAAGG - Intergenic
984427523 4:179606964-179606986 AAGGGCCCCCAGAGCTCTGAGGG + Intergenic
984737592 4:183125035-183125057 GAGGGGACCCGGGGCTATGAGGG + Intronic
984762515 4:183375334-183375356 GAGGGGCCCCAGACATCTGAAGG + Intergenic
985848046 5:2368424-2368446 GAGGGGCCTCAGACCTACGAAGG - Intergenic
985898319 5:2764025-2764047 GAGGTTGCCCACAGCTATCACGG + Intergenic
985976951 5:3427157-3427179 TAGGGAGACCAGACCTATGATGG + Intergenic
988798652 5:34675684-34675706 GAGGCTGCAGAGAGCTATGATGG + Intronic
990444179 5:55878716-55878738 GAGGTTGCCATGAGCTATGATGG - Intronic
990975401 5:61556194-61556216 AAGGGGGCAGCGAGCTATGATGG + Intergenic
991454733 5:66790607-66790629 GAGGTGGCAGTGAGCTATGATGG - Intronic
991669433 5:69033138-69033160 GATGAGGCCCAGAGATTTGAGGG - Intergenic
994182365 5:96781798-96781820 GTGGGGGCCCAGAGCACAGAAGG - Exonic
996091596 5:119356660-119356682 GAGGGGGCTGAAAGATATGAGGG + Intronic
999061248 5:148638271-148638293 GAGGGGGCTCAGAGTTCTGCAGG - Intronic
999826292 5:155276684-155276706 GAGGGGGCCAAGAGGTAGCAAGG - Intergenic
1001774342 5:174317350-174317372 GAGGGGTCCCAGGGCCCTGAGGG + Intergenic
1001923477 5:175618736-175618758 GAGGCTGCCGTGAGCTATGATGG - Intergenic
1003094060 6:3128636-3128658 GAGGGGACCCTGAGCTCTGCTGG - Intronic
1006446801 6:34084305-34084327 CAGGGGGCACAGAGCTAGGTGGG + Intronic
1008527504 6:52420834-52420856 GAGAGGGCCCAGAGATAGGTTGG - Intronic
1009245477 6:61231847-61231869 GAGGGGTCCCACGGCTCTGAAGG + Intergenic
1011585134 6:88916406-88916428 GAGGGGGCTGTGAGCTGTGATGG + Intronic
1012378880 6:98596126-98596148 GAAGGTGCCAAGTGCTATGAGGG + Intergenic
1013410219 6:109877124-109877146 AAGAGGCCCCAGAGCAATGAGGG - Intergenic
1020328828 7:6997949-6997971 GAGGCTGCAAAGAGCTATGATGG + Intergenic
1022478244 7:30726012-30726034 GCTGGAGCCCAGAGCTGTGAGGG + Intronic
1022943237 7:35258535-35258557 GAGGAGGCCCGGGGCTCTGAGGG - Intergenic
1026117011 7:67504091-67504113 GAGGGTGCAGTGAGCTATGAAGG + Intergenic
1027239664 7:76318633-76318655 GAGGGGGCCCAGACCTGGGCCGG + Intergenic
1030845387 7:114402689-114402711 GAGGTGGCAGTGAGCTATGATGG - Intronic
1032670270 7:134075806-134075828 GAGGGGGCACTGAGCTCTGGAGG - Intergenic
1033276954 7:139978888-139978910 GAGGCTGCAGAGAGCTATGATGG + Intronic
1034313407 7:150109988-150110010 GAGGGGTCCCACTGCCATGAAGG + Intergenic
1034501360 7:151452975-151452997 GTGGGGGCCCTGAGCTAAGCTGG - Intergenic
1034793454 7:153990676-153990698 GAGGGGTCCCACTGCCATGAAGG - Intronic
1035374203 7:158396592-158396614 GAGGCCACCCAGAGCTCTGAAGG + Intronic
1040815739 8:51506873-51506895 GAGGGTGCTCAGACTTATGAGGG - Intronic
1043459222 8:80442592-80442614 GAGGGTGCAGTGAGCTATGATGG - Intergenic
1048354774 8:133644312-133644334 GAGGCTGCACAGAGCTTTGATGG - Intergenic
1048494652 8:134925145-134925167 GAGAGTGCCCAGAGCCATAAGGG + Intergenic
1049603844 8:143520112-143520134 GGGGGTGCCCAGAGCTCTGCAGG + Intronic
1053630995 9:39938031-39938053 GAGGCTGCCATGAGCTATGATGG - Intergenic
1053774773 9:41525474-41525496 GAGGCTGCCATGAGCTATGATGG + Intergenic
1054212892 9:62312667-62312689 GAGGCTGCCATGAGCTATGATGG + Intergenic
1054949700 9:70836198-70836220 GATGGGGCCCAGAGCTAAGGAGG - Intronic
1055470780 9:76608132-76608154 GAGGGGGCACAGAGAAATGATGG + Intergenic
1057009541 9:91589475-91589497 GAGGGAGCACAGAGTTCTGACGG + Intronic
1057782259 9:98059477-98059499 GAGGTGGCAATGAGCTATGATGG - Intronic
1057890050 9:98863135-98863157 GAGGGATCCCAGAGCAATAAGGG - Intergenic
1057894145 9:98893568-98893590 GAGAGAGCCAAGAGCTATAACGG - Intergenic
1060646787 9:125287438-125287460 GGGGAGGCACAGAGCCATGATGG + Intronic
1060795040 9:126507553-126507575 GAGGAGGCAAAGAGCTTTGATGG - Intergenic
1061265221 9:129500819-129500841 TAGGGGGCCAAGAGCCAGGAGGG - Intergenic
1061299858 9:129698157-129698179 GAGGGGGCCCAGAGAGCTGAAGG - Intronic
1061872679 9:133529089-133529111 CAGAGGTCCCAGAGCTAGGATGG - Intergenic
1062282635 9:135758869-135758891 GGGGGTGCCCAGAGCTGCGAGGG + Intronic
1185515913 X:698955-698977 GTGGGGGCCCAGTGGTAAGAAGG + Intergenic
1187053745 X:15720229-15720251 GAGGCTGCACTGAGCTATGATGG - Intronic
1187852381 X:23604009-23604031 GAGGAGGCCCAGAGTCAGGATGG - Intergenic
1189066059 X:37810465-37810487 CAGGGGGCACAGAGCCCTGAAGG + Intronic
1190273930 X:48888085-48888107 GAGGGTGCAGTGAGCTATGATGG + Intergenic
1190879000 X:54479451-54479473 TTTGGGGCCCACAGCTATGAAGG + Intronic
1192679979 X:73242134-73242156 GGGGGAGCCCAGAGCCTTGAAGG + Intergenic
1193786079 X:85760899-85760921 GAGGGAGACCAGAGGTGTGAGGG - Intergenic
1195918041 X:109955182-109955204 GAGAAGGCCCAGAGCTATCTTGG + Intergenic
1197745499 X:129930301-129930323 GAGTGGGCCCTGAGTTAGGAAGG - Intergenic
1198909890 X:141601675-141601697 GAGAGGGCCCAGAAATAGGATGG - Intronic
1198927357 X:141814309-141814331 GAAGAGGCCCAGTGCTATGCTGG - Intergenic
1199897374 X:152137698-152137720 GAGGAGTCCCAGAGCCCTGAGGG - Intronic
1199947520 X:152680590-152680612 GAGGAGTCCCAGAGCTCTGAAGG + Intergenic
1199962159 X:152787864-152787886 GAGGAGTCCCAGAGCTCTGAAGG - Intergenic
1202377834 Y:24254921-24254943 GAGGAGGGCTAGAGCTCTGAGGG + Intergenic
1202492948 Y:25415200-25415222 GAGGAGGGCTAGAGCTCTGAGGG - Intergenic