ID: 1184098670

View in Genome Browser
Species Human (GRCh38)
Location 22:42330080-42330102
Sequence AATCTGCAGGGCCACTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 178}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184098670_1184098676 11 Left 1184098670 22:42330080-42330102 CCATCTGAGTGGCCCTGCAGATT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1184098676 22:42330114-42330136 TGAGCAGACAACCCCTGGCCAGG 0: 1
1: 0
2: 0
3: 20
4: 185
1184098670_1184098682 23 Left 1184098670 22:42330080-42330102 CCATCTGAGTGGCCCTGCAGATT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1184098682 22:42330126-42330148 CCCTGGCCAGGGCCTCTCAGGGG 0: 1
1: 2
2: 5
3: 72
4: 727
1184098670_1184098677 12 Left 1184098670 22:42330080-42330102 CCATCTGAGTGGCCCTGCAGATT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1184098677 22:42330115-42330137 GAGCAGACAACCCCTGGCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 156
1184098670_1184098675 6 Left 1184098670 22:42330080-42330102 CCATCTGAGTGGCCCTGCAGATT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1184098675 22:42330109-42330131 CAAGCTGAGCAGACAACCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 169
1184098670_1184098680 22 Left 1184098670 22:42330080-42330102 CCATCTGAGTGGCCCTGCAGATT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1184098680 22:42330125-42330147 CCCCTGGCCAGGGCCTCTCAGGG 0: 1
1: 1
2: 3
3: 46
4: 413
1184098670_1184098684 24 Left 1184098670 22:42330080-42330102 CCATCTGAGTGGCCCTGCAGATT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1184098684 22:42330127-42330149 CCTGGCCAGGGCCTCTCAGGGGG 0: 1
1: 1
2: 5
3: 56
4: 644
1184098670_1184098678 21 Left 1184098670 22:42330080-42330102 CCATCTGAGTGGCCCTGCAGATT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1184098678 22:42330124-42330146 ACCCCTGGCCAGGGCCTCTCAGG 0: 1
1: 1
2: 3
3: 37
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184098670 Original CRISPR AATCTGCAGGGCCACTCAGA TGG (reversed) Intronic
900826966 1:4934733-4934755 AATCTGCAGTTCCACTCCCAAGG - Intergenic
901916265 1:12502910-12502932 ACTCTGCAGGGCCACTGTGATGG - Intronic
906017753 1:42597685-42597707 AAACTCTAGGGCCACTCAGCTGG - Intronic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
909106698 1:71419042-71419064 ATTCTACAGGGCTCCTCAGAGGG + Intronic
910529644 1:88221066-88221088 CATCAGCAGGGGCACTCGGAAGG + Intergenic
910711877 1:90190214-90190236 AAGCAGAAGGGCCGCTCAGATGG - Intergenic
918118039 1:181513877-181513899 CATCTGAAGAGCCACTAAGAAGG - Intronic
919871424 1:201824598-201824620 AAGCTGCAGGGACACGAAGACGG + Exonic
919993520 1:202726593-202726615 AAGCTGCAGGACTACTGAGATGG + Exonic
920572256 1:207026120-207026142 ATTCTTCAGGCCCACTCAGATGG + Intronic
920758081 1:208754513-208754535 ATTCTGCAGACCCAGTCAGAAGG - Intergenic
922145730 1:222942374-222942396 AAAATGAAGGGCCACTCTGAGGG - Intronic
922167832 1:223130451-223130473 TTTCTGCAGGGCCACGAAGAGGG - Intronic
922931057 1:229390035-229390057 AATTTGGAGGGGGACTCAGAGGG + Intergenic
922974465 1:229772195-229772217 GATCTCCAGGGCTACTCACAAGG + Intergenic
923755377 1:236786451-236786473 AAACTGCAGGGCCCCAAAGAGGG - Intergenic
1063731869 10:8706913-8706935 ACTGTGCAGGGTCACTCATAGGG + Intergenic
1063766802 10:9151173-9151195 AATGGGCAGGGCCAGTCAGTGGG - Intergenic
1066517799 10:36183328-36183350 AATCTGCTGTGCCATTCACAAGG + Intergenic
1067175384 10:43942340-43942362 GAACTGCAGGGCCTCTCACAGGG - Intergenic
1067192616 10:44083790-44083812 AATCTTCAGAGCAAATCAGATGG + Intergenic
1067698701 10:48553429-48553451 AATCTGTAGGGGTCCTCAGATGG + Intronic
1074232521 10:111551823-111551845 AATTTGCAGGCACACTGAGAAGG + Intergenic
1076462088 10:130654698-130654720 AACTTGCAGGGGCCCTCAGAGGG + Intergenic
1076798032 10:132808229-132808251 CACGTGCAGGGCCCCTCAGAAGG - Intergenic
1076934583 10:133558890-133558912 CTTCTGCAGGGCCTCACAGATGG + Exonic
1077291428 11:1796716-1796738 AGTCTTCAGCGCCACTCAGGAGG + Intergenic
1079401757 11:20111617-20111639 AGTCTGCAGGGTAACTCAAAAGG + Intronic
1080317234 11:30964091-30964113 AATCTCCAGGGCCACTCCTAGGG + Intronic
1082716673 11:56622508-56622530 TATCTGCATGGCCACTTACATGG + Intergenic
1084565745 11:69927770-69927792 GATCAGCAGGGCCTCTCAGGAGG + Intergenic
1085635306 11:78154624-78154646 AATCTGCAGGGCAAACCAGCAGG + Intergenic
1085785569 11:79445507-79445529 AAGCTCCAGGGCCACACAGAAGG - Intergenic
1086455834 11:86957637-86957659 AGTCTGGAGGGCTACTCAAAGGG + Intergenic
1087037811 11:93772441-93772463 AAACTGCAGGGCCTCAAAGAGGG + Intronic
1089182899 11:116595164-116595186 ATCCTGTAGGGCCATTCAGAGGG + Intergenic
1089468266 11:118700215-118700237 AATTAGCTGGGCTACTCAGAAGG + Intergenic
1089681048 11:120119195-120119217 AAGCTGCCAGGGCACTCAGAGGG + Intronic
1089699242 11:120234487-120234509 ACTCTCCAGGGCCACTGGGAAGG - Intergenic
1089963784 11:122638487-122638509 AATCTCCTGGGCCCATCAGAGGG - Intergenic
1091146632 11:133285822-133285844 AATGTGCAGGGCCTTACAGAGGG - Intronic
1092289195 12:7149053-7149075 AATGAGCAGTGCCACTCAGCAGG - Exonic
1096539237 12:52295536-52295558 AACCTGCAGGGCCCTGCAGAGGG - Intronic
1100519487 12:95359542-95359564 AGCCTTCAGGGCCACTCAGCTGG - Intergenic
1104467463 12:129002601-129002623 AAGCTGCCCGGCCACTCAGCAGG - Intergenic
1105239135 13:18594942-18594964 CCTCTGCTGGGCCACTCAGCAGG + Intergenic
1105481217 13:20777815-20777837 AATTTACAGGGACACTCAGTAGG + Exonic
1107761531 13:43684495-43684517 ACCCTTCATGGCCACTCAGAAGG - Intronic
1107831122 13:44374230-44374252 ACTCTGCAGGACCCCGCAGAAGG - Intronic
1108957738 13:56182469-56182491 AATCTGCAGGGCTCCACAGTTGG - Intergenic
1109865687 13:68260538-68260560 AATCTCCAAGGCTACTCTGATGG + Intergenic
1110555124 13:76851261-76851283 AATTTGCAGAGCCACTTTGATGG - Intergenic
1113655530 13:112066346-112066368 AACCTGCAGGGGCCCTCGGAGGG + Intergenic
1115187154 14:30701897-30701919 AATCTGCAGCTCCCCTCAGTTGG + Intronic
1116255188 14:42545717-42545739 CATCTGAAGTGCCACTGAGAGGG - Intergenic
1116866654 14:50036930-50036952 AATATGCGGGGCCTCTGAGAAGG - Intergenic
1117619983 14:57575770-57575792 AATTTTCAGAGCCAATCAGAAGG + Intronic
1118072707 14:62263304-62263326 AATCTCCAGGGAACCTCAGAAGG - Intergenic
1118982787 14:70730073-70730095 ACTCTGCAGGGTCACTCTAAAGG + Exonic
1119766921 14:77196113-77196135 ACACCGCTGGGCCACTCAGAAGG + Intronic
1120999083 14:90438518-90438540 CATCAACAGGGCCACACAGAGGG - Intergenic
1122138257 14:99646907-99646929 AATCTGCATGGCCACCCAGGGGG - Intronic
1122778709 14:104134660-104134682 ATTCAGCAGGGCCCCTCTGATGG - Intergenic
1123102804 14:105817178-105817200 AATCTGCAGGGCAAACCAGCAGG - Intergenic
1125101730 15:35921282-35921304 AATTTTCTGGCCCACTCAGATGG - Intergenic
1125522040 15:40353702-40353724 AACATGCAGGACCACTCAGGTGG + Intronic
1128634698 15:69295696-69295718 CATCAGCAGGGCAACTCTGACGG + Intergenic
1131681160 15:94725290-94725312 TATCCGCAGGGCCACAGAGATGG - Intergenic
1132496254 16:264848-264870 AGTCTGCCGGGCCTGTCAGAAGG - Exonic
1133315831 16:4883474-4883496 ACTCTGCAGGGCCTCTTCGATGG + Exonic
1135020372 16:18957892-18957914 AATGTGCCTGGCTACTCAGATGG + Intergenic
1135433475 16:22407791-22407813 AATCTGTATGGCCCCTTAGAAGG - Intronic
1136066404 16:27761781-27761803 ATTCTCCAGGGCCACACAGCTGG + Intronic
1137263732 16:46852003-46852025 GACCTGCAGGGCAACTCTGAAGG - Intergenic
1138452365 16:57101170-57101192 AATCTGTAGGGCAAGCCAGAAGG - Intronic
1139118732 16:63989055-63989077 AAACTGAAAAGCCACTCAGAAGG - Intergenic
1142108670 16:88319536-88319558 CATGTGCAGCGCCTCTCAGAGGG + Intergenic
1143029551 17:3960181-3960203 AGCAAGCAGGGCCACTCAGATGG + Intronic
1144628434 17:16857398-16857420 AATCCGCAACGCCACTCAGGAGG - Intergenic
1146466867 17:33093225-33093247 AATCAGAAGGGCCACTCACTTGG - Intronic
1150129135 17:62657549-62657571 AAGGTGCAGGGCCCCTCACAAGG - Intronic
1151235622 17:72717823-72717845 GATGTGCAGGGTCACTCCGAGGG - Intronic
1152308752 17:79536487-79536509 ATTAAGCAGGGCCACTCAGCTGG - Intergenic
1155830783 18:30513198-30513220 AATCTGCAGGGCCTCAAAGAGGG + Intergenic
1157334625 18:46728974-46728996 AAACTGCAGGGCCACTCCTGGGG - Intronic
1158129412 18:54136259-54136281 CTTCAGCAGGGCCACTCAGCTGG - Intergenic
1158783270 18:60677722-60677744 TATTTGCTGGACCACTCAGAGGG - Intergenic
1164705982 19:30320629-30320651 CATCTGCAAGGCCTCCCAGAGGG - Intronic
1164779753 19:30882881-30882903 ACCCTGCAGGGCCATTCAGGTGG + Intergenic
1166951110 19:46428582-46428604 AATCTTCGAGCCCACTCAGAGGG - Intergenic
1167668584 19:50836910-50836932 AGTCTGCAGGCCCCCTGAGAAGG - Intronic
926344025 2:11929346-11929368 AAAATGCAGGGCCACTAGGATGG + Intergenic
928509395 2:31988146-31988168 AGTCTGCAGGACCTTTCAGAAGG + Intronic
928879787 2:36085125-36085147 ACTCTGAAGAGCCACTCACATGG + Intergenic
929607511 2:43244787-43244809 ACTCTGCAGAGCCTCCCAGAGGG + Intronic
933567439 2:83968493-83968515 AATCTGCAGGGTCAGCCAGTAGG + Intergenic
934047365 2:88183837-88183859 AGTCTGGATGGCCACTCAGTGGG - Intronic
938597007 2:132798013-132798035 AATTTGAAGGTCCACTGAGAAGG - Intronic
940561799 2:155306844-155306866 ATCCTGGAGTGCCACTCAGAGGG + Intergenic
946346370 2:219114223-219114245 AATCAGCAGGGTCTCACAGATGG - Intronic
1171345114 20:24460061-24460083 AAGCTGCAGAGCCACTCTGCAGG - Intergenic
1172234223 20:33359063-33359085 TCTCTGCAGGACCACTCTGAGGG - Exonic
1172608237 20:36230114-36230136 CATCTGCAGTGGCCCTCAGAAGG - Exonic
1173182519 20:40815680-40815702 TATCTGCAGGCCTACACAGAAGG + Intergenic
1173308591 20:41875310-41875332 CAGCTGCAGGTCAACTCAGATGG - Intergenic
1175827007 20:61941893-61941915 ACCCTGCGGGGCCACTGAGATGG - Intergenic
1179269814 21:39841837-39841859 AAACTGTTAGGCCACTCAGATGG - Intergenic
1183319637 22:37157140-37157162 AAGCTGCAGGGGCCCACAGAGGG + Intronic
1184098670 22:42330080-42330102 AATCTGCAGGGCCACTCAGATGG - Intronic
1184256032 22:43287519-43287541 AGAAAGCAGGGCCACTCAGACGG + Intronic
1184762524 22:46552654-46552676 GATCAGCAGAGCCACTCAGTGGG + Intergenic
1185210658 22:49568863-49568885 TCTCTGCAAGGCCACACAGAGGG - Intronic
1185221171 22:49629891-49629913 TCCCTGCTGGGCCACTCAGATGG + Intronic
950602299 3:14045541-14045563 GATCTGCAGGGCCACTATGATGG - Intronic
950707857 3:14793994-14794016 AATCTGCCTGGCCACTTAGCAGG - Intergenic
954374602 3:50187685-50187707 AATCTGCAGGGGCAAGGAGAGGG - Exonic
954976577 3:54700945-54700967 AATATGCTGGGACTCTCAGAGGG - Intronic
955783443 3:62510630-62510652 AATCTACAGGGCTATGCAGATGG - Intronic
956638673 3:71393773-71393795 AATCTCTAGGGCCACTTACATGG + Intronic
956766932 3:72491984-72492006 AATCTCAAGGGCCACTCATAAGG + Intergenic
960662322 3:120074177-120074199 TATCTGCAGTACCACTCAGGAGG + Intronic
961670475 3:128524636-128524658 CTTGTGCAGGGCCACACAGAGGG - Intergenic
962351119 3:134656442-134656464 GATCAGCATCGCCACTCAGATGG - Intronic
964588761 3:158337234-158337256 CTTCTGCAGCCCCACTCAGAAGG - Intronic
965376771 3:167934492-167934514 AATGTGCAGGGCAAGTCAGGAGG + Intergenic
969883170 4:10192469-10192491 AATTTGCAGGAACACTCACACGG + Intergenic
972000298 4:34023422-34023444 AATCAGCAGGGACACACAGCTGG - Intergenic
974645357 4:64683454-64683476 AATCAACAAGGCAACTCAGAAGG + Intergenic
974852728 4:67422987-67423009 AATCTGCAGGGCAAGCCAGCAGG - Intergenic
974891672 4:67891574-67891596 AAGCACCAGGGTCACTCAGAAGG + Intergenic
976522423 4:86044138-86044160 AATTTCCACGTCCACTCAGAGGG + Intronic
978155688 4:105487246-105487268 AAACTGCATGGCCACTAGGATGG + Intergenic
980007686 4:127559994-127560016 AAACTGCAGGGCCCCAAAGAGGG - Intergenic
982523734 4:156452223-156452245 AATGTGCAGGGCCACTGAGGTGG - Intergenic
985147942 4:186913811-186913833 AATCTCCAGGGCCACACAAGGGG + Intergenic
992611519 5:78512161-78512183 AATCTGCTGGGCACCTCAGTTGG - Intronic
999107148 5:149083837-149083859 AATCTCCACAGCAACTCAGAAGG + Intergenic
999277093 5:150338692-150338714 TCTCTGCAGGCCCATTCAGATGG + Intronic
1001415829 5:171544390-171544412 GGTTAGCAGGGCCACTCAGAAGG + Intergenic
1001858324 5:175032000-175032022 AATCTGGGAGGCCACTGAGAAGG - Intergenic
1002460634 5:179371838-179371860 GAGCCGCAGGGCCACACAGATGG + Intergenic
1002560745 5:180080362-180080384 AGTCTGCAGAGCCACTCATCTGG + Intergenic
1007504973 6:42328671-42328693 AGTCTTAAGGGCCACTCTGAAGG + Intronic
1008535994 6:52506580-52506602 TATAAGCAGGGCCACACAGAAGG - Intronic
1009469540 6:64015688-64015710 AATCTGAAGGTCCTCACAGAGGG + Intronic
1011584688 6:88911843-88911865 CATCTGCTTGGCCTCTCAGAGGG - Intronic
1017217809 6:151930704-151930726 ATTCTGCAGGGCAAGTCAGCTGG + Intronic
1017955015 6:159169953-159169975 AATCTCCCGGGACACTTAGACGG - Intronic
1019732581 7:2636048-2636070 AGGCTGGATGGCCACTCAGAGGG + Intronic
1019932297 7:4231822-4231844 AATCACCAGGTACACTCAGATGG - Intronic
1022194602 7:28051985-28052007 AAACTGCAGGTTCACTCTGAGGG + Intronic
1023456242 7:40341796-40341818 ATTCTGCTGGCCAACTCAGAAGG - Intronic
1023833056 7:44051361-44051383 AAGTTCCAGGGCCACCCAGACGG - Intronic
1024432620 7:49307114-49307136 CATCTGCAGGGCAAGTCAGTAGG - Intergenic
1027926487 7:84471201-84471223 TACCTGCAAGGCCACTCATAAGG - Intronic
1028378826 7:90176071-90176093 AATCTGCAGAGCCTCAGAGAGGG + Intronic
1029730391 7:102434438-102434460 CATCTGCAGGGCCTCACCGATGG + Intronic
1034268842 7:149793665-149793687 AATCGGCAGGGTCTCTGAGAGGG + Intergenic
1035821410 8:2596293-2596315 AATGTGCAGGGGTGCTCAGAAGG - Intergenic
1036932588 8:12970523-12970545 AATCTGTAGGACCGCCCAGAAGG - Intronic
1043858255 8:85286391-85286413 TTTCTGCAGCCCCACTCAGAAGG - Intergenic
1045285828 8:100790540-100790562 GATCAGCTGGGCCACTCAGCTGG - Intergenic
1046115444 8:109778506-109778528 CATGTGCAGGGCCACTGACAGGG - Intergenic
1049237781 8:141521064-141521086 AGTCTGCCTGGCCACTGAGAAGG + Intergenic
1050210769 9:3253447-3253469 ATTCTTCAGGGCCACCCTGAAGG - Intronic
1053471076 9:38346529-38346551 ACTCTTCAGGGCCACTCACACGG + Intergenic
1055027987 9:71742850-71742872 AAACTGGAAAGCCACTCAGATGG + Intronic
1055735910 9:79329730-79329752 AATCTCCAGGGCCTCACACAGGG + Intergenic
1060771777 9:126337175-126337197 AAGTTGCAGGGCCAATCAGGAGG - Intronic
1061092350 9:128433812-128433834 TATCTGCAGGGGCCCTCAGGAGG - Intronic
1062202575 9:135312723-135312745 AAGCTGCATGGCCACAGAGAAGG + Intergenic
1187655994 X:21474425-21474447 ATTCTGCAGGGCTTCTCAGAAGG - Intronic
1189865152 X:45320217-45320239 AATCTCCTGGGACAATCAGAAGG + Intergenic
1195322686 X:103732643-103732665 ATTCTGAAGGTCCATTCAGAAGG - Intergenic
1198508222 X:137322848-137322870 AATCAGCAGGGGCACCAAGATGG - Intergenic
1199542878 X:148977039-148977061 AGCCTGCAGGGCCACTGAGCTGG - Intronic
1200012321 X:153128036-153128058 AATCTCCAGGGCCACCCGAAGGG + Intergenic
1200027279 X:153271883-153271905 AATCTCCAGGGCCACCCGAAGGG - Intergenic
1200684958 Y:6249870-6249892 AATCTGCAGTGCCAATCACGAGG - Intergenic
1200990488 Y:9341141-9341163 AATCTGCAGTGCCAATCACGAGG - Intergenic
1200993150 Y:9361458-9361480 AATCTGCAGTGCCAATCACGAGG - Intronic
1200995804 Y:9381728-9381750 AATCTGCAGTGCCAATCACGAGG - Intergenic
1200998468 Y:9402080-9402102 AATCTGCAGTGCCAATCACGAGG - Intergenic
1201000978 Y:9470610-9470632 AATCTGCAGTGCCAATCACGAGG - Intronic
1201003645 Y:9490938-9490960 AATCTGCAGTGCCAATCACGAGG - Intergenic
1201006301 Y:9511220-9511242 AATCTGCAGTGCCAATCACGAGG - Intergenic
1201008959 Y:9531529-9531551 AATCTGCAGTGCCAATCACGAGG - Intergenic
1201053917 Y:9968916-9968938 AATATGTAAGGCAACTCAGATGG + Intergenic
1202116360 Y:21472064-21472086 AATCTGCAGTGCCAATCACTGGG - Intergenic