ID: 1184099354

View in Genome Browser
Species Human (GRCh38)
Location 22:42333921-42333943
Sequence CAGGGGCCACCCGTTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184099354_1184099366 9 Left 1184099354 22:42333921-42333943 CCCAGGCCAACGGGTGGCCCCTG 0: 1
1: 0
2: 4
3: 10
4: 139
Right 1184099366 22:42333953-42333975 GGAGTTTAGCAGACTCCTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 108
1184099354_1184099369 24 Left 1184099354 22:42333921-42333943 CCCAGGCCAACGGGTGGCCCCTG 0: 1
1: 0
2: 4
3: 10
4: 139
Right 1184099369 22:42333968-42333990 CCTGTGGGAACAGGCTCACAAGG 0: 1
1: 0
2: 2
3: 15
4: 192
1184099354_1184099365 8 Left 1184099354 22:42333921-42333943 CCCAGGCCAACGGGTGGCCCCTG 0: 1
1: 0
2: 4
3: 10
4: 139
Right 1184099365 22:42333952-42333974 TGGAGTTTAGCAGACTCCTGTGG 0: 1
1: 0
2: 1
3: 15
4: 146
1184099354_1184099367 15 Left 1184099354 22:42333921-42333943 CCCAGGCCAACGGGTGGCCCCTG 0: 1
1: 0
2: 4
3: 10
4: 139
Right 1184099367 22:42333959-42333981 TAGCAGACTCCTGTGGGAACAGG 0: 1
1: 0
2: 0
3: 13
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184099354 Original CRISPR CAGGGGCCACCCGTTGGCCT GGG (reversed) Intronic
900236832 1:1597072-1597094 CAGGGGACAAGCCTTGGCCTGGG - Intergenic
900548565 1:3242107-3242129 CAGGGGCCTGGCGCTGGCCTGGG - Intronic
900655303 1:3753950-3753972 GAGGGGCCACACGGTGTCCTGGG + Intronic
900655548 1:3755020-3755042 GAGGGGCCACACGGTGTCCTGGG + Intronic
902931940 1:19737675-19737697 CGGGGGCTGCCTGTTGGCCTTGG - Intronic
904586717 1:31584807-31584829 CAGGCGCCAGCCCTTGCCCTTGG - Intronic
905205203 1:36339451-36339473 CAGGTGCCACCCGCTGGCTGCGG + Intergenic
907440347 1:54474884-54474906 CAGGGGCCGCGCGTTGCCATGGG + Intergenic
918042460 1:180921593-180921615 CACAGGCCACCCCTTGGGCTAGG + Intronic
920380017 1:205529702-205529724 TGGAGGCCACCCCTTGGCCTTGG - Intronic
921944404 1:220877068-220877090 CAGGGGCCAGGCTTGGGCCTGGG + Intergenic
922620022 1:226983497-226983519 CAGGGCCCACCCGTCTCCCTGGG + Intronic
923149048 1:231217713-231217735 CTGGGGCCACCTGGTGACCTGGG - Intronic
1065060943 10:21899856-21899878 CAGAGGCCACCCCTCTGCCTAGG + Intronic
1069809676 10:71148965-71148987 CAGGGGCCATCCTGTGGCCCAGG - Intergenic
1070587797 10:77779850-77779872 CAGAGACCTCCCCTTGGCCTAGG + Intergenic
1071284524 10:84132209-84132231 CAGGTGCCACCTTTTTGCCTTGG - Intergenic
1075777834 10:124999500-124999522 CAAGGGCCACCCCTAGGTCTAGG + Intronic
1076645238 10:131949190-131949212 CATGAGCCTCTCGTTGGCCTGGG + Intronic
1077338240 11:2014842-2014864 CAAGGCCCACCCCTGGGCCTAGG - Intergenic
1078098211 11:8313354-8313376 CTGGGGACACCTGTGGGCCTTGG - Intergenic
1078581431 11:12542350-12542372 CAGGGGCCACACCTGGGCCGGGG - Intergenic
1084285515 11:68128365-68128387 CAGCGGGCAGCCGCTGGCCTTGG - Intergenic
1084396175 11:68911937-68911959 CAGGGGCCTGGAGTTGGCCTGGG + Intronic
1084460695 11:69295049-69295071 CTGGGGCCACCCGGTGGATTTGG + Intronic
1084657596 11:70528380-70528402 CAGGTGCCACCTGGTGGCCATGG + Intronic
1089457098 11:118632085-118632107 CTGGGGCCTTCAGTTGGCCTAGG - Intronic
1089596926 11:119586357-119586379 CAGAGACCTCCCCTTGGCCTAGG - Intergenic
1090408125 11:126489611-126489633 CAGGGGACACCAGCTGTCCTGGG - Intronic
1202821224 11_KI270721v1_random:70024-70046 CAAGGCCCACCCCTGGGCCTAGG - Intergenic
1092030355 12:5278583-5278605 CAGGTGCCACCCGTTCTCCAGGG - Intergenic
1096693083 12:53333030-53333052 CTGGGGTCTCCTGTTGGCCTGGG - Intronic
1097052253 12:56230578-56230600 GAGGGGCCACCCTCTGCCCTGGG - Intronic
1100957277 12:99922894-99922916 CAGATGCCACCCCTTGACCTTGG + Intronic
1102128079 12:110501912-110501934 CAGGGCCCAGGCGCTGGCCTGGG - Intronic
1103885566 12:124197731-124197753 GAGGGGCCAGAGGTTGGCCTGGG + Intronic
1104938981 12:132386104-132386126 AAGGGGTCAGCCGTTGGCCCCGG + Intergenic
1107711008 13:43150781-43150803 CAGGTACCACCCATTGTCCTGGG - Intergenic
1108453911 13:50594619-50594641 AAGGGGCCACCCGGTGGCCTAGG - Intronic
1112977811 13:105342461-105342483 CATGAGCAACCCATTGGCCTGGG + Intergenic
1113675908 13:112207835-112207857 CAGGGCCCAGCCGTGGGCCCAGG - Intergenic
1113713957 13:112489346-112489368 CAGGGGCCACCCTTTGGCCAGGG + Intronic
1113847743 13:113402222-113402244 CAGAGGCCACCGAGTGGCCTGGG + Intergenic
1114924912 14:27384178-27384200 GTGGGGCCACTCCTTGGCCTGGG + Intergenic
1121015054 14:90544053-90544075 CAGGGGCCACACACTGCCCTCGG - Intronic
1122118437 14:99538983-99539005 CAGGGGCAGCCCCTTGGTCTGGG - Intronic
1122296354 14:100708513-100708535 CAGGAGCCACCCAGAGGCCTTGG - Intergenic
1122481408 14:102049784-102049806 CAGGGACCAGCTGTTGGCCTGGG - Exonic
1125590745 15:40853320-40853342 CCGGGGCCATTGGTTGGCCTAGG - Intronic
1127362113 15:58253089-58253111 CAAGAGCAACCCGTCGGCCTGGG + Intronic
1127665354 15:61140731-61140753 CAGGGGTCAGCCCTTTGCCTAGG + Intronic
1130140875 15:81225329-81225351 CAGTGGCCACCCGTCAGCCAAGG + Intronic
1131130224 15:89894204-89894226 CTGGGGCCAGCCGTCGGTCTGGG - Exonic
1132065676 15:98728724-98728746 CAAAGGCCACCAGCTGGCCTCGG - Intronic
1132116145 15:99137879-99137901 TTGGGGCCAACAGTTGGCCTTGG + Exonic
1132672635 16:1108031-1108053 CAGGGGCCACCCCATGTCCAAGG - Intergenic
1135789379 16:25379595-25379617 CAGAGGCAACCCCTTGACCTTGG - Intergenic
1136540143 16:30924164-30924186 CAAGGAGCCCCCGTTGGCCTGGG + Intronic
1137782243 16:51107537-51107559 CAGGGGCCACACTCTGGTCTGGG - Intergenic
1139160860 16:64507253-64507275 CATGTGCCACCTGTAGGCCTGGG - Intergenic
1139692673 16:68651065-68651087 CAGGGGCCTTCCCTGGGCCTGGG + Intronic
1141957604 16:87383288-87383310 CGGGGGCCACCAGTTGGGCGCGG - Intronic
1144149019 17:12425453-12425475 CAGGGGCCAGGCGTTGCACTTGG + Intergenic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1149734746 17:58982425-58982447 GAGGGGCCACCCATAGGCATTGG - Exonic
1151720357 17:75851866-75851888 CAGGGGTCATCCGCTCGCCTCGG - Intronic
1152754722 17:82082469-82082491 CAGGGTCCCCCCCTTGGTCTTGG + Intronic
1152854289 17:82655323-82655345 CACGGGCCGCCCGGAGGCCTTGG - Exonic
1157753211 18:50195958-50195980 CAGGGGCCACCCCTGGGTCAGGG - Intergenic
1160824390 19:1072933-1072955 CAAAGGCCAGACGTTGGCCTAGG - Intronic
1163762611 19:19145800-19145822 CCGGGGCCAGCCGTCGGCCAAGG + Exonic
1167434325 19:49470362-49470384 CAGGGGCTGCCCGCGGGCCTGGG + Exonic
1167599819 19:50448082-50448104 CAGAAACAACCCGTTGGCCTCGG - Intronic
924996620 2:367245-367267 CAGGGGCCTCCTGGAGGCCTTGG + Intergenic
925388881 2:3482421-3482443 CAGGGGCTACCTCTGGGCCTGGG - Intronic
926085866 2:10020058-10020080 CAGCGGCCACCCGTTGTCCTGGG - Intergenic
929578694 2:43068457-43068479 CGGGGGCCGCCCGTGGGCCTGGG + Intergenic
930052308 2:47225896-47225918 GAGGGGCCACACATTGGCCTTGG - Intergenic
930800174 2:55435646-55435668 AAGGGGCCACCCGGGGGACTAGG + Intergenic
932340774 2:70961448-70961470 CCGGGGTCACCCCATGGCCTTGG + Intronic
937957136 2:127427805-127427827 CAGTGGCCCCCCGTGGGGCTTGG + Intronic
943369564 2:187001391-187001413 CAGAGACCTCCCGTTGGCCTAGG + Intergenic
944338793 2:198570000-198570022 CCTGGGCCACCCCTGGGCCTTGG - Intronic
944581541 2:201137041-201137063 CAGAGACCTCCCCTTGGCCTAGG + Intronic
948126317 2:235567161-235567183 CAAGGGCTGCCCGCTGGCCTGGG - Intronic
948785364 2:240349689-240349711 CAGGGGCCACCCCATGGCAGGGG - Intergenic
948798418 2:240418959-240418981 CAGGTGATACCAGTTGGCCTTGG + Intergenic
948983613 2:241507628-241507650 CGGGGGCCACCCTGCGGCCTCGG - Intronic
1173292396 20:41726387-41726409 CTGGGGCCACCAGCTGGCGTAGG - Intergenic
1175921865 20:62453858-62453880 CAGGGACCTCCCGTGGGCCTGGG + Intergenic
1181030417 22:20146791-20146813 TAGGGGCCACCTGTTGGCTCAGG + Intronic
1183588300 22:38765861-38765883 CAGGGGCCACCCAATGAGCTGGG + Intronic
1183698703 22:39437813-39437835 AAGGGGTCTCCCCTTGGCCTGGG - Intergenic
1184099354 22:42333921-42333943 CAGGGGCCACCCGTTGGCCTGGG - Intronic
1184968073 22:47995949-47995971 AAGGGGCCAGCCTTTGTCCTGGG + Intergenic
953046616 3:39298557-39298579 CACGTGCAACCTGTTGGCCTGGG + Intergenic
953221207 3:40973417-40973439 CAGGGACCACCCCTTGGCATAGG + Intergenic
956128255 3:66031519-66031541 CAGTGGCCACCCCTTGTCATTGG - Intronic
961061642 3:123833527-123833549 CAGGGGCCTCCCGTGTGCATGGG - Intronic
968426375 4:526275-526297 CTGGGGCCACACGGGGGCCTGGG - Intronic
969282838 4:6182752-6182774 CAGGGGCTCCCCGCTGGCCCAGG - Intronic
969392657 4:6901648-6901670 CAGGGGCCACCCAGTGTCCCAGG - Intergenic
969441755 4:7221319-7221341 CTGGGTCCACCCGTAGGCCCAGG - Intronic
969533110 4:7740425-7740447 CGTGGGCCCCCCGTGGGCCTGGG - Exonic
969870820 4:10103676-10103698 CATGGGCCACCGGTTGGACAAGG + Intronic
970620367 4:17811244-17811266 CAGGGGCCCTCCGTGGCCCTCGG + Intronic
971322493 4:25616677-25616699 GAGGGGCCCCAAGTTGGCCTGGG + Intergenic
984766986 4:183407248-183407270 CGGGCGCCACCCAGTGGCCTCGG + Intergenic
985733845 5:1566082-1566104 CAGGGGCCACCCGATGCCTCTGG - Intergenic
1000794585 5:165649028-165649050 TAGGGGCCACCCTGTGTCCTTGG - Intergenic
1001220242 5:169894423-169894445 CAGGGCCCAACAGTTGTCCTTGG - Intronic
1002254616 5:177949921-177949943 CAGGAGCCCCCAGTGGGCCTCGG - Intergenic
1002483376 5:179517891-179517913 CAGGAGCCCCCAGTGGGCCTCGG + Intergenic
1004230185 6:13826048-13826070 CAGATGCCACCCCTTGACCTTGG - Intergenic
1006582888 6:35086855-35086877 CAGGGGCCACAGCCTGGCCTGGG + Intronic
1009266044 6:61556043-61556065 CTGGGGCCACTGGTGGGCCTAGG + Intergenic
1013520002 6:110924219-110924241 CAGGAGCCCCCCCATGGCCTGGG + Intergenic
1014747213 6:125214179-125214201 CAGGGGCTTCCCATTGGCCAAGG + Intronic
1017281229 6:152628296-152628318 GAGGGGCCTCCCGGTGTCCTCGG - Exonic
1018970587 6:168526025-168526047 CAGGGGCCACCTGTTTCCCCAGG + Intronic
1019172700 6:170142972-170142994 CAGGAGCCACCCAGGGGCCTCGG - Intergenic
1020002924 7:4765849-4765871 CAGGGGCCACCAAATGGCCTCGG - Exonic
1023054880 7:36283383-36283405 CAGGGGCTCCCCGATGGCCCTGG - Intronic
1026846044 7:73699767-73699789 CAGGAGCAACCCCTTGGGCTAGG - Exonic
1028115328 7:86990475-86990497 CAGATGCCACCCCTTGACCTTGG + Intronic
1029514948 7:101018400-101018422 CTGGGGCCACCCCTTCCCCTGGG + Intronic
1031686820 7:124740408-124740430 AAGATGCCACCCCTTGGCCTTGG + Intergenic
1032018103 7:128392533-128392555 CAGAGACCTCCCCTTGGCCTAGG + Exonic
1033097362 7:138442675-138442697 CAGAGACCTCCCCTTGGCCTAGG - Intergenic
1033457755 7:141517866-141517888 CAGGGCCCAGCCATTGGCCCTGG - Intergenic
1036690092 8:10939808-10939830 CAGGGCCCAGCCCCTGGCCTTGG - Intronic
1037688752 8:21165421-21165443 CAGGGGCCACCCAAAGCCCTAGG + Intergenic
1037916958 8:22778648-22778670 CTGGGGCCACCCTGTGGACTGGG + Intronic
1038035087 8:23680760-23680782 CAGAAGCCTCCTGTTGGCCTTGG - Exonic
1040073279 8:43205273-43205295 CTGGGGCCATCCGATGGCCTGGG - Intergenic
1040973689 8:53165946-53165968 CAATGGTCACCCGTTTGCCTGGG - Intergenic
1041200837 8:55451163-55451185 CGGGGGACACCCGTTGGCCTGGG + Intronic
1048427377 8:134335362-134335384 AAGGGGGCATCCATTGGCCTGGG + Intergenic
1049442975 8:142617585-142617607 CAGGGGCCACCCTGTGCCTTGGG + Intergenic
1049521823 8:143095248-143095270 CACTGGCCACCCCTTGGCCCTGG - Intergenic
1052695161 9:31869027-31869049 CATGGGCCACCCGTGAGCCTGGG - Intergenic
1052941079 9:34132708-34132730 CAGAGACCTCCCCTTGGCCTAGG + Intergenic
1057038679 9:91831970-91831992 AAGGAGGCACCCGTTGGTCTGGG - Intronic
1057182977 9:93039831-93039853 CTGGGACCACCCGAAGGCCTGGG - Intergenic
1059326409 9:113506498-113506520 CAGGGGACAGCGGGTGGCCTGGG + Intronic
1061061800 9:128254267-128254289 CTGGGGCCACCCCTTGCCTTGGG - Intronic
1061420687 9:130471617-130471639 CGGGGGCCAGCCGTGGGGCTGGG + Intronic
1189361708 X:40358713-40358735 CAGAGACCTCCCGCTGGCCTAGG + Intergenic
1189658905 X:43277625-43277647 CAGAGACCTCCCCTTGGCCTAGG + Intergenic
1196748905 X:119096937-119096959 CAGGGGCACCCCATTGTCCTTGG + Intronic
1200039719 X:153356157-153356179 CAGTGGCCACCCAGAGGCCTGGG - Intronic
1200150188 X:153947468-153947490 CAGGGGGCTCCCGTGAGCCTCGG + Intergenic
1200163509 X:154020694-154020716 CAGGGGCCAGCTGTGGGCCTTGG - Intergenic