ID: 1184100297

View in Genome Browser
Species Human (GRCh38)
Location 22:42338451-42338473
Sequence GGCCGGGCTGCCGGGAGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100297_1184100316 29 Left 1184100297 22:42338451-42338473 CCGTCCCTCCCGGCAGCCCGGCC No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100297_1184100306 -7 Left 1184100297 22:42338451-42338473 CCGTCCCTCCCGGCAGCCCGGCC No data
Right 1184100306 22:42338467-42338489 CCCGGCCTGCAGGGGCCACTCGG No data
1184100297_1184100313 19 Left 1184100297 22:42338451-42338473 CCGTCCCTCCCGGCAGCCCGGCC No data
Right 1184100313 22:42338493-42338515 ATCCCGAAGAGCTCGCTCAGGGG No data
1184100297_1184100311 17 Left 1184100297 22:42338451-42338473 CCGTCCCTCCCGGCAGCCCGGCC No data
Right 1184100311 22:42338491-42338513 CAATCCCGAAGAGCTCGCTCAGG No data
1184100297_1184100312 18 Left 1184100297 22:42338451-42338473 CCGTCCCTCCCGGCAGCCCGGCC No data
Right 1184100312 22:42338492-42338514 AATCCCGAAGAGCTCGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100297 Original CRISPR GGCCGGGCTGCCGGGAGGGA CGG (reversed) Intronic