ID: 1184100298

View in Genome Browser
Species Human (GRCh38)
Location 22:42338455-42338477
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100298_1184100318 30 Left 1184100298 22:42338455-42338477 CCCTCCCGGCAGCCCGGCCTGCA No data
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG No data
1184100298_1184100311 13 Left 1184100298 22:42338455-42338477 CCCTCCCGGCAGCCCGGCCTGCA No data
Right 1184100311 22:42338491-42338513 CAATCCCGAAGAGCTCGCTCAGG No data
1184100298_1184100317 29 Left 1184100298 22:42338455-42338477 CCCTCCCGGCAGCCCGGCCTGCA No data
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG No data
1184100298_1184100313 15 Left 1184100298 22:42338455-42338477 CCCTCCCGGCAGCCCGGCCTGCA No data
Right 1184100313 22:42338493-42338515 ATCCCGAAGAGCTCGCTCAGGGG No data
1184100298_1184100316 25 Left 1184100298 22:42338455-42338477 CCCTCCCGGCAGCCCGGCCTGCA No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100298_1184100312 14 Left 1184100298 22:42338455-42338477 CCCTCCCGGCAGCCCGGCCTGCA No data
Right 1184100312 22:42338492-42338514 AATCCCGAAGAGCTCGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100298 Original CRISPR TGCAGGCCGGGCTGCCGGGA GGG (reversed) Intronic