ID: 1184100302

View in Genome Browser
Species Human (GRCh38)
Location 22:42338459-42338481
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100302_1184100312 10 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG No data
Right 1184100312 22:42338492-42338514 AATCCCGAAGAGCTCGCTCAGGG No data
1184100302_1184100319 30 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data
1184100302_1184100318 26 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG No data
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG No data
1184100302_1184100311 9 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG No data
Right 1184100311 22:42338491-42338513 CAATCCCGAAGAGCTCGCTCAGG No data
1184100302_1184100313 11 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG No data
Right 1184100313 22:42338493-42338515 ATCCCGAAGAGCTCGCTCAGGGG No data
1184100302_1184100316 21 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100302_1184100317 25 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG No data
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100302 Original CRISPR CCCCTGCAGGCCGGGCTGCC GGG (reversed) Intronic