ID: 1184100309

View in Genome Browser
Species Human (GRCh38)
Location 22:42338482-42338504
Sequence GCTCTTCGGGATTGGCCGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100309_1184100317 2 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC No data
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG No data
1184100309_1184100319 7 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data
1184100309_1184100320 8 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC No data
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG No data
1184100309_1184100321 24 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC No data
Right 1184100321 22:42338529-42338551 GGCTGGGAAAATAATTACCGAGG 0: 1
1: 0
2: 1
3: 7
4: 83
1184100309_1184100322 27 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC No data
Right 1184100322 22:42338532-42338554 TGGGAAAATAATTACCGAGGAGG No data
1184100309_1184100316 -2 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100309_1184100318 3 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC No data
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100309 Original CRISPR GCTCTTCGGGATTGGCCGAG TGG (reversed) Intronic