ID: 1184100310

View in Genome Browser
Species Human (GRCh38)
Location 22:42338490-42338512
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100310_1184100325 28 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100325 22:42338541-42338563 AATTACCGAGGAGGCCCGGGAGG No data
1184100310_1184100322 19 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100322 22:42338532-42338554 TGGGAAAATAATTACCGAGGAGG No data
1184100310_1184100326 29 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100326 22:42338542-42338564 ATTACCGAGGAGGCCCGGGAGGG No data
1184100310_1184100316 -10 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100310_1184100321 16 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100321 22:42338529-42338551 GGCTGGGAAAATAATTACCGAGG 0: 1
1: 0
2: 1
3: 7
4: 83
1184100310_1184100324 25 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100324 22:42338538-42338560 AATAATTACCGAGGAGGCCCGGG No data
1184100310_1184100319 -1 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data
1184100310_1184100317 -6 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG No data
1184100310_1184100318 -5 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG No data
1184100310_1184100320 0 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG No data
1184100310_1184100323 24 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100323 22:42338537-42338559 AAATAATTACCGAGGAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100310 Original CRISPR CTGAGCGAGCTCTTCGGGAT TGG (reversed) Intronic