ID: 1184100310

View in Genome Browser
Species Human (GRCh38)
Location 22:42338490-42338512
Sequence CTGAGCGAGCTCTTCGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100310_1184100321 16 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100321 22:42338529-42338551 GGCTGGGAAAATAATTACCGAGG No data
1184100310_1184100326 29 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100326 22:42338542-42338564 ATTACCGAGGAGGCCCGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 82
1184100310_1184100323 24 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100323 22:42338537-42338559 AAATAATTACCGAGGAGGCCCGG 0: 1
1: 0
2: 0
3: 21
4: 206
1184100310_1184100322 19 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100322 22:42338532-42338554 TGGGAAAATAATTACCGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 120
1184100310_1184100316 -10 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1184100310_1184100318 -5 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 267
1184100310_1184100324 25 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100324 22:42338538-42338560 AATAATTACCGAGGAGGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 75
1184100310_1184100319 -1 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG 0: 1
1: 0
2: 5
3: 58
4: 617
1184100310_1184100325 28 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100325 22:42338541-42338563 AATTACCGAGGAGGCCCGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1184100310_1184100317 -6 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG 0: 1
1: 0
2: 0
3: 37
4: 275
1184100310_1184100320 0 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100310 Original CRISPR CTGAGCGAGCTCTTCGGGAT TGG (reversed) Intronic
901167154 1:7229171-7229193 CTGAGAGAGCTCTAGGGGACAGG + Intronic
905245746 1:36612096-36612118 CTAAGGGTGCTCTTGGGGATGGG + Intergenic
909726331 1:78840600-78840622 CTGTGGGAGCTCTTCGGGGTTGG - Intergenic
910897325 1:92082498-92082520 TTGAGTGAGCTCTTAGGGATTGG + Intronic
912715054 1:111977563-111977585 GTGAGCCATCTCATCGGGATCGG + Intronic
1073446603 10:103584700-103584722 TTGAGTGAGTTCTGCGGGATGGG - Exonic
1076632211 10:131857992-131858014 CTAAGAGACCTGTTCGGGATGGG - Intergenic
1104031934 12:125071092-125071114 GTGAGTGAGCTCTTGGGGACGGG - Intronic
1104291891 12:127477360-127477382 CTGAGCAAGCTCACTGGGATTGG - Intergenic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1118736734 14:68706216-68706238 CTGAGCGGGCTTTTCAGGATTGG + Intronic
1118966876 14:70595297-70595319 CTGAGCCAGCTCTTCGTATTAGG - Intronic
1128242382 15:66109802-66109824 CTGAGAGACCTCTTAGGGAGAGG - Intronic
1129600678 15:76996487-76996509 CAGAGCGTCCTCTTCGGGGTTGG - Intronic
1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG + Intronic
1147674019 17:42192686-42192708 CTGAGCCAGCACTTCTGGGTAGG + Exonic
1149470884 17:56914210-56914232 CCGCGGGAGCTCTTGGGGATCGG - Intergenic
1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG + Intronic
1167492535 19:49800902-49800924 ATGAGCGCCCTCTCCGGGATCGG - Intronic
935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG + Intronic
936565143 2:113577175-113577197 CTGAGGGGGCTCTCAGGGATGGG - Intergenic
938225174 2:129609653-129609675 CTCAGAGAGCTCATCTGGATTGG - Intergenic
947573912 2:231257430-231257452 CTGAGCCAGCTTTGCGGGAGAGG + Intronic
1171567675 20:26209362-26209384 CTGAGGGAGCTCGTCGGTGTGGG - Intergenic
1176547146 21:8206922-8206944 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1176566097 21:8389969-8389991 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1176573973 21:8434155-8434177 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1178261675 21:31105755-31105777 TTGGGAGAGCTCTTGGGGATAGG + Intergenic
1183665465 22:39243753-39243775 CTGGGTGACCTCTTCGGGCTGGG - Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184177660 22:42798251-42798273 CTGAGGGAACTCTCCGGAATGGG + Intronic
1203252021 22_KI270733v1_random:123207-123229 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
955496962 3:59543273-59543295 CTGATCCAGCTCTTAGGGAAGGG + Intergenic
972594147 4:40515546-40515568 CTGAGCACTCTCTTGGGGATTGG - Intronic
984288701 4:177765774-177765796 CTTAGTGAGCTATTTGGGATAGG + Intronic
1005870475 6:29971357-29971379 CAGAGGGAACTCTTAGGGATGGG + Intergenic
1019143188 6:169961157-169961179 CTGAGCGCCCTCATGGGGATTGG + Intergenic
1023559615 7:41460047-41460069 GTGAGCCTGCTCTTCGGCATGGG + Intergenic
1048934249 8:139342073-139342095 CTGAGCCAGATCCTCGGGTTAGG + Intergenic
1052611063 9:30774198-30774220 CTGAGCCAGCTCTTCGTTATTGG - Intergenic
1056570580 9:87811102-87811124 CTGAGAGAGCCCTTAGTGATGGG + Intergenic
1203468424 Un_GL000220v1:106357-106379 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1192139185 X:68633017-68633039 CTGAGCAAGCCCTTCTGGAAAGG - Intergenic
1197706224 X:129636511-129636533 CTGAGTGAGCTCAGAGGGATGGG - Intergenic