ID: 1184100314

View in Genome Browser
Species Human (GRCh38)
Location 22:42338495-42338517
Sequence AGCCCCTGAGCGAGCTCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100314_1184100318 -10 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG No data
1184100314_1184100321 11 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100321 22:42338529-42338551 GGCTGGGAAAATAATTACCGAGG 0: 1
1: 0
2: 1
3: 7
4: 83
1184100314_1184100322 14 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100322 22:42338532-42338554 TGGGAAAATAATTACCGAGGAGG No data
1184100314_1184100323 19 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100323 22:42338537-42338559 AAATAATTACCGAGGAGGCCCGG No data
1184100314_1184100326 24 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100326 22:42338542-42338564 ATTACCGAGGAGGCCCGGGAGGG No data
1184100314_1184100324 20 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100324 22:42338538-42338560 AATAATTACCGAGGAGGCCCGGG No data
1184100314_1184100327 27 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100327 22:42338545-42338567 ACCGAGGAGGCCCGGGAGGGAGG No data
1184100314_1184100329 30 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100329 22:42338548-42338570 GAGGAGGCCCGGGAGGGAGGCGG No data
1184100314_1184100320 -5 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG No data
1184100314_1184100325 23 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100325 22:42338541-42338563 AATTACCGAGGAGGCCCGGGAGG No data
1184100314_1184100319 -6 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100314 Original CRISPR AGCCCCTGAGCGAGCTCTTC GGG (reversed) Intronic