ID: 1184100315

View in Genome Browser
Species Human (GRCh38)
Location 22:42338496-42338518
Sequence CAGCCCCTGAGCGAGCTCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100315_1184100329 29 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100329 22:42338548-42338570 GAGGAGGCCCGGGAGGGAGGCGG No data
1184100315_1184100319 -7 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data
1184100315_1184100325 22 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100325 22:42338541-42338563 AATTACCGAGGAGGCCCGGGAGG No data
1184100315_1184100330 30 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100330 22:42338549-42338571 AGGAGGCCCGGGAGGGAGGCGGG No data
1184100315_1184100324 19 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100324 22:42338538-42338560 AATAATTACCGAGGAGGCCCGGG No data
1184100315_1184100326 23 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100326 22:42338542-42338564 ATTACCGAGGAGGCCCGGGAGGG No data
1184100315_1184100320 -6 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG No data
1184100315_1184100323 18 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100323 22:42338537-42338559 AAATAATTACCGAGGAGGCCCGG No data
1184100315_1184100321 10 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100321 22:42338529-42338551 GGCTGGGAAAATAATTACCGAGG 0: 1
1: 0
2: 1
3: 7
4: 83
1184100315_1184100322 13 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100322 22:42338532-42338554 TGGGAAAATAATTACCGAGGAGG No data
1184100315_1184100327 26 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100327 22:42338545-42338567 ACCGAGGAGGCCCGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100315 Original CRISPR CAGCCCCTGAGCGAGCTCTT CGG (reversed) Intronic