ID: 1184100316

View in Genome Browser
Species Human (GRCh38)
Location 22:42338503-42338525
Sequence GCTCGCTCAGGGGCTGCGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 143}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100310_1184100316 -10 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1184100304_1184100316 20 Left 1184100304 22:42338460-42338482 CCGGCAGCCCGGCCTGCAGGGGC No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1184100302_1184100316 21 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG 0: 1
1: 0
2: 4
3: 43
4: 438
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1184100307_1184100316 12 Left 1184100307 22:42338468-42338490 CCGGCCTGCAGGGGCCACTCGGC 0: 1
1: 0
2: 3
3: 27
4: 248
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1184100299_1184100316 24 Left 1184100299 22:42338456-42338478 CCTCCCGGCAGCCCGGCCTGCAG 0: 1
1: 0
2: 5
3: 36
4: 395
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1184100309_1184100316 -2 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1184100308_1184100316 8 Left 1184100308 22:42338472-42338494 CCTGCAGGGGCCACTCGGCCAAT 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1184100297_1184100316 29 Left 1184100297 22:42338451-42338473 CCGTCCCTCCCGGCAGCCCGGCC 0: 1
1: 0
2: 6
3: 93
4: 671
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1184100296_1184100316 30 Left 1184100296 22:42338450-42338472 CCCGTCCCTCCCGGCAGCCCGGC 0: 1
1: 0
2: 11
3: 52
4: 402
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1184100305_1184100316 13 Left 1184100305 22:42338467-42338489 CCCGGCCTGCAGGGGCCACTCGG 0: 1
1: 0
2: 2
3: 44
4: 302
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1184100298_1184100316 25 Left 1184100298 22:42338455-42338477 CCCTCCCGGCAGCCCGGCCTGCA 0: 1
1: 0
2: 5
3: 28
4: 316
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100316 Original CRISPR GCTCGCTCAGGGGCTGCGAG TGG Intronic
902649844 1:17829887-17829909 GCTGGGTCAGGGGCTGGGTGGGG + Intergenic
904268063 1:29329301-29329323 TCTCAATCAGGGGCTGAGAGAGG - Intergenic
904676901 1:32204307-32204329 GGTCACTGAGGGGCTGCCAGAGG + Exonic
905251019 1:36648383-36648405 GCTGGATCAGGGGCTCCCAGGGG + Intergenic
907550540 1:55301203-55301225 CCTCTCTCCGGGGCTGCTAGTGG + Intergenic
910182958 1:84505870-84505892 GCGCGCTCAGCGGCGGCGATCGG - Intronic
910846662 1:91610856-91610878 TCTTGCTCAGGGACTGGGAGAGG + Intergenic
915593099 1:156881646-156881668 GCCGGCCCAGGGGCTGGGAGTGG + Intronic
920809379 1:209267949-209267971 GCTGGCTCTGGGGCTGGGATTGG - Intergenic
924037534 1:239952797-239952819 GCTGGCTCTGGAGCTGCCAGAGG + Intergenic
1066566366 10:36725726-36725748 GCTGACTCAGGGGCTGGCAGAGG - Intergenic
1069419274 10:68231717-68231739 GCCCGCTCAGGACCTGCGCGTGG + Exonic
1069886898 10:71629436-71629458 GGAGGCTCAGGGGCTGGGAGGGG + Intronic
1070576451 10:77682485-77682507 GGTTGCTCAGGGGCTGCCAGGGG + Intergenic
1075587709 10:123669428-123669450 GCTAGCTCAGGGGCTGCCCCAGG + Intronic
1076178661 10:128388118-128388140 GCTGAGTCAGGGGCTGCTAGTGG + Intergenic
1076364998 10:129916043-129916065 GGTCCCACAGGGGCTCCGAGGGG + Intronic
1076994769 11:292528-292550 GCTCCCTGAGGGGTTGGGAGGGG - Exonic
1079128461 11:17734651-17734673 GCTCGGTGCGGGGCTGGGAGGGG + Intergenic
1082072574 11:47950839-47950861 GCTTGCTGAGGGGCTGCTACGGG + Intergenic
1083609374 11:63997889-63997911 GCTGGCTCAGGGGCTTCTATGGG + Exonic
1084192421 11:67505075-67505097 GCTTGCTCGCGGGGTGCGAGTGG - Intronic
1084425341 11:69081177-69081199 GGTCGCTCCGGGGCTGCAGGTGG + Intronic
1084502992 11:69545867-69545889 GCTCTCTGAGGGGCTACGGGAGG - Intergenic
1084764982 11:71302313-71302335 GCTCGCACAGGGGATGCTGGAGG - Intergenic
1085473006 11:76769925-76769947 GCTGTCTCAGGGGAGGCGAGTGG - Intergenic
1086616908 11:88831860-88831882 GCTTGCTCAGGTGCTGGTAGTGG - Intronic
1089531745 11:119134412-119134434 GGTGGCTCAGGGGCTGGGGGAGG - Exonic
1091715762 12:2775134-2775156 GTTCCCTCTGGGGCTGGGAGTGG - Intergenic
1092285140 12:7124356-7124378 GCTGGGTCAGGGGATGTGAGTGG + Intronic
1096459449 12:51814266-51814288 GCTCGTACAGGGGCTGCGGCAGG + Intergenic
1096620589 12:52862235-52862257 GCTGACTCAGGAGCTGGGAGAGG - Intergenic
1107508540 13:41060109-41060131 GCTTGCTCAGGCGCCGCGGGTGG + Intronic
1111176721 13:84605756-84605778 GCTTGCTCAGGTGCTGAGAGTGG + Intergenic
1113631981 13:111894070-111894092 GCTGGCTCATGGGCAGGGAGAGG + Intergenic
1113851896 13:113422742-113422764 CCTCACCCAGGGGCTGCGAGAGG + Exonic
1114268894 14:21089669-21089691 GCTAGCTCTGGGCCTGGGAGGGG - Exonic
1119219455 14:72894130-72894152 GTTCGCTCAGGGGAAGCGACGGG + Intergenic
1121604524 14:95230772-95230794 CCTGGCACAGGGGCTGCCAGTGG + Intronic
1124243815 15:28053432-28053454 TCTGGCACAGGGGCTGGGAGAGG - Intronic
1132240256 15:100252408-100252430 TTTTGCTCAGGGGCTGCCAGGGG + Intronic
1132314373 15:100879661-100879683 GCTCCCGCAGGGGCGGCGGGCGG + Exonic
1135040844 16:19115469-19115491 GCTCCCTGAGGGCCTGCGTGCGG + Exonic
1138379279 16:56589272-56589294 GCGCGCACAGCGGCGGCGAGTGG + Intronic
1140517715 16:75556215-75556237 GCTCGCGGAGTGCCTGCGAGCGG - Exonic
1141595246 16:85093242-85093264 GCTCCCACAGGGGCTGGGGGTGG + Exonic
1143676383 17:8436067-8436089 GCTCCCTAAGGGGCTGCGCTGGG + Intronic
1144759374 17:17698678-17698700 GCTGGCTCAGGGGCTGAGAGGGG - Intronic
1144775258 17:17781992-17782014 GCGCGCAGAGTGGCTGCGAGAGG - Intronic
1145103411 17:20095588-20095610 GCTGGCTAACGGGCTGTGAGGGG + Intronic
1147259004 17:39197748-39197770 GCCGGCGGAGGGGCTGCGAGGGG - Intergenic
1147719369 17:42529221-42529243 GGTTGCTCCGGGGCTGGGAGTGG - Intergenic
1148534640 17:48429624-48429646 GCTCTCCAGGGGGCTGCGAGGGG - Intronic
1150284056 17:63945667-63945689 CCTCTCTCAGAGGCTGGGAGAGG - Intronic
1150284345 17:63946820-63946842 GCTGGATCGGGGGCTGAGAGTGG + Intronic
1151554032 17:74837623-74837645 GCTCCCTTAGGGGCTGAGCGTGG + Exonic
1152801622 17:82333457-82333479 GCACGCTCAGGGCCAGCGGGGGG + Intronic
1157302083 18:46486359-46486381 GGTGGCTGAGGGGCTGGGAGTGG - Intronic
1157823376 18:50790199-50790221 GCAGGCTAAGGGGCTGCAAGGGG + Intergenic
1158530597 18:58256498-58256520 GCTCGCTTCGGGGCTGCGTGGGG - Intronic
1160004895 18:75062450-75062472 GGCCACTCAGGGGCTGAGAGGGG - Intronic
1161394347 19:4037377-4037399 ACTCGCTCAGGATCTTCGAGAGG - Exonic
1163534821 19:17871141-17871163 GCTCACTGAGGTGGTGCGAGGGG - Intergenic
1163722226 19:18903707-18903729 GCTGGCTCAGGGTCTGAGTGGGG + Intronic
1163748909 19:19063975-19063997 GCGCGCTCTGGGGGTGCGCGAGG + Intergenic
1163795527 19:19335636-19335658 GCTCGCTCTGGGGCTTCCACAGG - Intronic
1163832665 19:19554479-19554501 GCTTACTCAGGGGCAGTGAGGGG + Intergenic
1164086831 19:21910663-21910685 AATCACTCAGGGGCTGGGAGAGG - Intergenic
1164937371 19:32224763-32224785 GCTCGCCACGGGTCTGCGAGCGG + Intergenic
1165162682 19:33827046-33827068 GCTCTCTCAGGGGCCTCCAGTGG + Intergenic
1165486096 19:36097098-36097120 GGTTGCTCAGGGGCTGGCAGAGG + Intronic
1166321557 19:42022178-42022200 GGAGGCTCAGGGCCTGCGAGTGG - Intronic
1166347771 19:42177024-42177046 GGGCGGGCAGGGGCTGCGAGGGG + Intronic
1166994574 19:46714142-46714164 GCTCGCGCTGGGGTTGGGAGGGG - Intronic
1167129058 19:47572729-47572751 GCGAGCTGGGGGGCTGCGAGGGG + Intergenic
1167369426 19:49071926-49071948 GCGGGGCCAGGGGCTGCGAGGGG - Intronic
1167505701 19:49870000-49870022 GCGCGCGCTGGTGCTGCGAGAGG - Exonic
927400439 2:22704283-22704305 GCTGGCTCAGGGGCTGGTAGTGG - Intergenic
935817445 2:106859981-106860003 GCTGACTCAGGGGCAGCAAGGGG - Intronic
938038193 2:128053803-128053825 GCTGGCTGAGGGGCTGGGGGTGG + Intergenic
940145591 2:150542269-150542291 TCTCACACAGGGGCTGCAAGTGG + Intergenic
944048647 2:195440826-195440848 GCTTGCTCAGGTGCTGGAAGTGG - Intergenic
945564253 2:211377116-211377138 GATCTCTCAGGGGCTGGGAGGGG - Exonic
946248306 2:218399310-218399332 CCTCGCCCTGGGGCTGCGGGGGG + Intronic
947840078 2:233202167-233202189 CCTCTCTCAGGGGCTGAGATGGG - Intronic
948528834 2:238589987-238590009 GCTCCCTGGGGGGCTGGGAGAGG + Intergenic
1169141025 20:3227714-3227736 GCTGGCTCTGGAGCTGTGAGGGG - Exonic
1171502280 20:25603282-25603304 GTTCTCTCAGGGGGTGAGAGAGG + Intergenic
1174406628 20:50307037-50307059 GCAGGCTCAGGAGCTGGGAGTGG + Intergenic
1175758045 20:61542368-61542390 CCTCTCTCAGAGGCTGCGGGAGG - Intronic
1176376273 21:6088295-6088317 GCTGGCTGAGGGGCTGGGATGGG - Intergenic
1179747202 21:43449949-43449971 GCTGGCTGAGGGGCTGGGATGGG + Intergenic
1182137407 22:27919008-27919030 ACTCGCTGAGGGGCTTCGAAGGG + Intronic
1183355070 22:37354209-37354231 TCTCCCTCGAGGGCTGCGAGGGG - Intergenic
1183509466 22:38226583-38226605 GCTCACTCCGGGGCTGGCAGCGG + Intronic
1183788106 22:40043617-40043639 GGTTGGTCAGGGGTTGCGAGTGG + Intergenic
1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG + Intronic
1184238303 22:43198272-43198294 GCTCACTCAGGGGCTCTGAGTGG + Exonic
1184294531 22:43515315-43515337 GCTCAGGCAGGGGCTGCGTGGGG + Intergenic
1184370213 22:44077203-44077225 GCTCCCTCCAGGGCTCCGAGAGG + Intronic
950509154 3:13415358-13415380 GCTCCCGCAGGGCCTGGGAGAGG - Intronic
951024649 3:17816530-17816552 GCCTGCTCAGGGGCAGCCAGTGG + Intronic
953009431 3:39010666-39010688 GGTGGCTCACGGGCTGGGAGTGG - Intergenic
954149208 3:48648853-48648875 GCTGGCTCAGCGGCTACGGGAGG - Exonic
955175850 3:56612508-56612530 GCTTGCTCAGGTGCTGAGAATGG + Intronic
957197478 3:77088548-77088570 GGTCTCTCAGGGGCAGCGTGGGG - Intronic
959422808 3:106149047-106149069 TCTCGCACAGGGGCTGCAGGTGG - Intergenic
967107780 3:186268281-186268303 GCCAGCTCAGTGGCTGCCAGTGG + Intronic
967930242 3:194685910-194685932 GCCCTCTCCGGTGCTGCGAGCGG - Intergenic
970642286 4:18080337-18080359 GCTGGCTCAGGGGTTGAGAGTGG + Intergenic
970757493 4:19443703-19443725 GCTTGCTCAGGTGCTGGCAGTGG - Intergenic
985770189 5:1804983-1805005 GTACGATCAGGGGCTGCCAGGGG - Intronic
988369339 5:30346166-30346188 TCCCGCACAGGGGCTGCAAGTGG - Intergenic
990796909 5:59553871-59553893 GCTCTGTGAGGGGCTGCTAGAGG - Intronic
997209855 5:132070816-132070838 GCTGACTCAGGGGCTCCGATGGG - Intergenic
997302212 5:132814111-132814133 GCTAGCTCAAGGGCTGGAAGCGG - Exonic
997608411 5:135192976-135192998 GCGCATTCAGGGACTGCGAGTGG + Intronic
1000891742 5:166810141-166810163 TCTCGCACAGGGGCTGCAGGTGG + Intergenic
1002948608 6:1786458-1786480 GCTTGCTCAGGCTGTGCGAGGGG - Intronic
1003156647 6:3602936-3602958 GCTTGCTCAGGTGCTGGAAGGGG + Intergenic
1003995738 6:11537987-11538009 CCTCGCTCGGGGGCCGCGCGAGG + Intergenic
1005183552 6:23136812-23136834 GCTTGCTCAGGTGCTGTAAGTGG + Intergenic
1010244880 6:73653759-73653781 GGTCGTCCAGGGGCTTCGAGTGG - Intronic
1017249147 6:152261107-152261129 ACTAGCTTAGGGGCTGGGAGAGG - Intronic
1019656892 7:2200762-2200784 GCACGCTCAGTGGCTGCAGGGGG - Intronic
1022091131 7:27108766-27108788 GCTGGGTCAGGGGCTGGGCGGGG - Intronic
1026440388 7:70438726-70438748 GTTAGCTCTGGGGCTTCGAGGGG - Intronic
1029707318 7:102282797-102282819 GCTCGCTGTGGGGCTGAGGGGGG - Intronic
1030732050 7:113002049-113002071 GCTGTCTGAGGGGCTGGGAGTGG + Intergenic
1031604334 7:123749474-123749496 GCTCGCTCTGCGGGTCCGAGAGG + Intergenic
1033365440 7:140670051-140670073 GGTGGCTCAGGGGCTGGGCGTGG - Intronic
1033365447 7:140670072-140670094 GGTGGCTCAGGGGCTGGGCGAGG - Intronic
1034488417 7:151380586-151380608 CCCCGCTCAGGTGCTGTGAGGGG + Intronic
1034872575 7:154696949-154696971 ACTCTCTCAGGGGCTGGGACAGG - Intronic
1034992249 7:155555236-155555258 GCACCCTCAGGGGCTGGGAAGGG + Intergenic
1035425061 7:158765148-158765170 GCGCGCTCTGGGGCTGCGTGGGG - Intronic
1036788768 8:11704217-11704239 GCCGGCGCAGGGGCCGCGAGAGG + Exonic
1039953963 8:42193232-42193254 GCTTGATCACGGGGTGCGAGAGG + Intronic
1044623813 8:94217154-94217176 GCTCACTCAGCGGCTGCTACGGG - Intronic
1048602675 8:135934717-135934739 GCTGTGTCAGGGGCTGCGGGAGG + Intergenic
1048901479 8:139042022-139042044 GCTCGCTCCTGAGCTGTGAGAGG + Intergenic
1050123730 9:2335068-2335090 GCTGGCTCAGGAGCTCCAAGTGG - Intergenic
1052956125 9:34254393-34254415 GTTCCCTCAGGGGCTGCGGTGGG + Exonic
1056474051 9:86935939-86935961 GCTCGCACATGTGCTGCTAGCGG + Intergenic
1056750408 9:89346792-89346814 GCTCGCCCAGGGGCTGCCTCAGG - Intronic
1056905393 9:90642963-90642985 GCAGGTGCAGGGGCTGCGAGCGG - Exonic
1057854581 9:98592872-98592894 GCTGGCTCAGGGCCTACCAGAGG - Intronic
1057992610 9:99786384-99786406 GATGGCTCAGAGGCTGCCAGAGG - Intergenic
1061631402 9:131874405-131874427 CCTAGCTCAGGGCCTCCGAGAGG + Intronic
1062082385 9:134631010-134631032 GCTTGGTCAGAGGCTGCGTGCGG - Intergenic
1062273110 9:135718734-135718756 GCTCGCTCACAGCCTGCCAGGGG - Intronic
1062348085 9:136124704-136124726 TCTCCCGCAGGGGCTCCGAGGGG - Intergenic
1189526197 X:41824635-41824657 GCTCACTGAGGGGCTGCTGGAGG - Intronic
1201422981 Y:13820152-13820174 TCTCGCACAGGGGCTGCAGGTGG + Intergenic