ID: 1184100316

View in Genome Browser
Species Human (GRCh38)
Location 22:42338503-42338525
Sequence GCTCGCTCAGGGGCTGCGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100305_1184100316 13 Left 1184100305 22:42338467-42338489 CCCGGCCTGCAGGGGCCACTCGG No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100302_1184100316 21 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100310_1184100316 -10 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100309_1184100316 -2 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100307_1184100316 12 Left 1184100307 22:42338468-42338490 CCGGCCTGCAGGGGCCACTCGGC No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100299_1184100316 24 Left 1184100299 22:42338456-42338478 CCTCCCGGCAGCCCGGCCTGCAG No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100304_1184100316 20 Left 1184100304 22:42338460-42338482 CCGGCAGCCCGGCCTGCAGGGGC No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100296_1184100316 30 Left 1184100296 22:42338450-42338472 CCCGTCCCTCCCGGCAGCCCGGC No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100297_1184100316 29 Left 1184100297 22:42338451-42338473 CCGTCCCTCCCGGCAGCCCGGCC No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100308_1184100316 8 Left 1184100308 22:42338472-42338494 CCTGCAGGGGCCACTCGGCCAAT No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data
1184100298_1184100316 25 Left 1184100298 22:42338455-42338477 CCCTCCCGGCAGCCCGGCCTGCA No data
Right 1184100316 22:42338503-42338525 GCTCGCTCAGGGGCTGCGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100316 Original CRISPR GCTCGCTCAGGGGCTGCGAG TGG Intronic