ID: 1184100317

View in Genome Browser
Species Human (GRCh38)
Location 22:42338507-42338529
Sequence GCTCAGGGGCTGCGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 275}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100308_1184100317 12 Left 1184100308 22:42338472-42338494 CCTGCAGGGGCCACTCGGCCAAT 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG 0: 1
1: 0
2: 0
3: 37
4: 275
1184100307_1184100317 16 Left 1184100307 22:42338468-42338490 CCGGCCTGCAGGGGCCACTCGGC 0: 1
1: 0
2: 3
3: 27
4: 248
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG 0: 1
1: 0
2: 0
3: 37
4: 275
1184100304_1184100317 24 Left 1184100304 22:42338460-42338482 CCGGCAGCCCGGCCTGCAGGGGC No data
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG 0: 1
1: 0
2: 0
3: 37
4: 275
1184100299_1184100317 28 Left 1184100299 22:42338456-42338478 CCTCCCGGCAGCCCGGCCTGCAG 0: 1
1: 0
2: 5
3: 36
4: 395
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG 0: 1
1: 0
2: 0
3: 37
4: 275
1184100309_1184100317 2 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG 0: 1
1: 0
2: 0
3: 37
4: 275
1184100310_1184100317 -6 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG 0: 1
1: 0
2: 0
3: 37
4: 275
1184100305_1184100317 17 Left 1184100305 22:42338467-42338489 CCCGGCCTGCAGGGGCCACTCGG 0: 1
1: 0
2: 2
3: 44
4: 302
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG 0: 1
1: 0
2: 0
3: 37
4: 275
1184100302_1184100317 25 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG 0: 1
1: 0
2: 4
3: 43
4: 438
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG 0: 1
1: 0
2: 0
3: 37
4: 275
1184100298_1184100317 29 Left 1184100298 22:42338455-42338477 CCCTCCCGGCAGCCCGGCCTGCA 0: 1
1: 0
2: 5
3: 28
4: 316
Right 1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG 0: 1
1: 0
2: 0
3: 37
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100317 Original CRISPR GCTCAGGGGCTGCGAGTGGA AGG Intronic
900368745 1:2322258-2322280 GCTCAGGGGAGGGGAGAGGATGG - Intronic
900467083 1:2831115-2831137 GCTCAGGGGCTGAGAGGGCTGGG - Intergenic
900474104 1:2868275-2868297 GGGCAGGGGCGGCGAGGGGAGGG + Intergenic
900476523 1:2878821-2878843 GCCCAGGGGCTGCCAGAGGTGGG - Intergenic
900546017 1:3229621-3229643 GCTCATGGGCTGCAAGTGGCTGG - Intronic
900585799 1:3431695-3431717 GCTCAGGTCTTGCCAGTGGAGGG - Intronic
902681398 1:18046343-18046365 GCCCTGGGGCAGCAAGTGGAGGG - Intergenic
902944421 1:19824453-19824475 GCTCATGGGCTTTGAGTGGAGGG + Intergenic
903658241 1:24961808-24961830 GCTCAGGGACTGAGATGGGATGG + Intronic
904581852 1:31549461-31549483 GGTCAGGAGTTGCCAGTGGAGGG + Intergenic
905191212 1:36236505-36236527 GCTCAGGGGAAGGGAGGGGAAGG - Intronic
905325909 1:37151886-37151908 GCTCAGGGCATGGGAGTGGCTGG - Intergenic
905873190 1:41416447-41416469 GCTGTGGGGCTGAGAGGGGAGGG + Intergenic
905874493 1:41423513-41423535 GTTCAGGGGCTGAGAGTAGTTGG - Intergenic
905948104 1:41920396-41920418 GAATAGGGGCTGCGAGGGGATGG + Intronic
906114764 1:43349163-43349185 GCCCAGGGGCGGCGAGGGGCGGG + Intronic
906614402 1:47224885-47224907 GCAGAGGGGCTGGGAGTGGAGGG + Intronic
907688801 1:56642094-56642116 GGTCAGGGGATGAGAGTGCAGGG + Intronic
910395809 1:86792822-86792844 TCTCAGCAGCTGCCAGTGGATGG + Intergenic
911462073 1:98203640-98203662 GGTCAGGGGCAGGGAGTGGAGGG + Intergenic
912829536 1:112939876-112939898 GGGCAGGGGCGGGGAGTGGAGGG - Intronic
914623642 1:149437159-149437181 GTACAGGGGCTGCCAGTGAATGG + Intergenic
914911453 1:151790608-151790630 GCTCAGGGGCAGCCCGCGGAAGG - Intronic
915724466 1:158007796-158007818 GCACAGGGGCTGCTGGTGGATGG - Intronic
917665644 1:177222846-177222868 GCTCAGTGACTGGAAGTGGAAGG + Intronic
917974608 1:180230687-180230709 GCTCAGGGGCCGGGAGGGGCTGG + Intronic
917979295 1:180259477-180259499 GCCCCGGGTGTGCGAGTGGAAGG + Intronic
918248655 1:182682648-182682670 GCTCAGTGGCCCTGAGTGGAGGG + Intronic
922236561 1:223726756-223726778 TATCAGGGGCTGGGAGGGGAGGG - Intronic
923126721 1:231040144-231040166 GTCCGGGGGCTGCGGGTGGACGG - Exonic
1063461093 10:6215442-6215464 GCTGCGGGGCTGCGGGTGTAAGG + Intronic
1063663893 10:8050664-8050686 GCTCCGGGGCTCCGGGGGGAGGG + Intergenic
1066174425 10:32888730-32888752 AAACAGGGGCTGCGTGTGGAGGG - Intergenic
1066749205 10:38635635-38635657 GCTTCGGAGCTGCGAGTGGGCGG - Intergenic
1066967453 10:42282157-42282179 GCTTCGGAGCTGCGAGTGGGCGG + Intergenic
1068065180 10:52121232-52121254 GCTCTGGGCCTGTGATTGGAGGG + Intronic
1068100668 10:52548674-52548696 GATCAGTGGTTGCCAGTGGATGG - Intergenic
1068756614 10:60661787-60661809 GCTCAGGGCCTCCCAGTGGGTGG - Intronic
1068762915 10:60733107-60733129 GCTCCGGGAGGGCGAGTGGAGGG - Intronic
1069780607 10:70953108-70953130 GCTCAGAGGTTGGGAGTGGAAGG - Intergenic
1069807681 10:71136238-71136260 GCCCTGGGGCTGCAACTGGAGGG - Intergenic
1070576453 10:77682489-77682511 GCTCAGGGGCTGCCAGGGGTGGG + Intergenic
1072001711 10:91201588-91201610 CCTCAGGGGCTGTGGGTGGAGGG - Intronic
1072578508 10:96720677-96720699 GCTCAGGGGCAGCGAGAAGGCGG + Intergenic
1076054609 10:127361697-127361719 GAGCAGGGGCTGCGAGTCGGGGG - Intronic
1077219718 11:1410591-1410613 ACTCGGGGGCTCCGAGTGCAGGG + Intronic
1077303481 11:1857539-1857561 TCTCAGGGGCTGGGACTGCAAGG - Intronic
1078328407 11:10398735-10398757 GCCCAGGGGCTGTGAGAGCAGGG - Intronic
1078696789 11:13642080-13642102 GTTCAGGGGCTGGGGGAGGAAGG - Intergenic
1078841556 11:15080318-15080340 GATCAGAGGCTGAGGGTGGAAGG - Intronic
1078902080 11:15650889-15650911 GCTCAGAGGCTGCCAGGGCAGGG - Intergenic
1079408486 11:20165281-20165303 GCTCAGAGGCTGGGAGTTGCTGG - Intergenic
1082778760 11:57269788-57269810 GCTCAGGGCCTGGGAATGGAGGG + Intergenic
1083297323 11:61722022-61722044 CCTCAGGGGCTGAGACTGGAGGG - Intronic
1083518437 11:63283187-63283209 GCTCAGGCACTGGGAGTGGTGGG + Intronic
1084366778 11:68706551-68706573 GCCCTGGGGCACCGAGTGGAGGG - Intergenic
1084466472 11:69325988-69326010 ACTCAGAGGCTAGGAGTGGATGG - Intronic
1084553313 11:69862024-69862046 GCTCAGGGGCAGGCAGTGGTGGG - Intergenic
1085095995 11:73761011-73761033 GCTCAGGCGCTGCGCGTGAGAGG - Exonic
1087297959 11:96399594-96399616 GCTCAGGGCCTGCGATGTGAGGG - Intronic
1088750199 11:112836536-112836558 GCTCAGAGGCCGTGAGGGGAAGG - Intergenic
1089127852 11:116190022-116190044 TCTCAGGAGCTGGGGGTGGAGGG + Intergenic
1089539880 11:119183371-119183393 GCCCAGCTGCTGCGAGTGGAGGG + Exonic
1089655604 11:119944588-119944610 GCAGAGGGGCTGAGAGGGGAGGG + Intergenic
1090033230 11:123225631-123225653 GCTGAGGGAGTGCGAGAGGAAGG - Intergenic
1090205622 11:124882476-124882498 GGTCAGGGCCTGGGACTGGAGGG - Intergenic
1090709901 11:129375241-129375263 GCTGCGAGACTGCGAGTGGAGGG + Intergenic
1091209187 11:133842175-133842197 GCACAGGGGCTGCGGTGGGAGGG + Intronic
1091974567 12:4814058-4814080 GCTTAGGGGCTGGGAGTGCCAGG + Intronic
1096195657 12:49647404-49647426 GCTCATAGGCTGTGAGGGGAGGG + Intronic
1097641900 12:62192137-62192159 GCTAAGTGGATTCGAGTGGAAGG - Exonic
1101875151 12:108592514-108592536 GCTCAGGCCCTGGGAATGGAAGG - Intronic
1102571894 12:113831818-113831840 GCTCAGGCGTGGGGAGTGGAAGG + Intronic
1103859383 12:124000108-124000130 CCTCAGGGGCTGCATGGGGAAGG - Intronic
1110767311 13:79295437-79295459 CCTCAGGGGCTAAGAATGGAAGG - Intergenic
1112336965 13:98524038-98524060 GCTTTGGGGCTGGGTGTGGACGG - Intronic
1116955248 14:50916686-50916708 GCTCAGGGATCGCGAGTGCAGGG + Exonic
1119199998 14:72745082-72745104 CCTCAGGGGGTGGGTGTGGAGGG + Intronic
1121301818 14:92877952-92877974 GGTCAAGGGCTGCTTGTGGAAGG - Intergenic
1121527423 14:94628748-94628770 GCTCAGGGCCTGCATTTGGAGGG - Intergenic
1121564694 14:94900461-94900483 TGCCAGGGGCTGGGAGTGGACGG + Intergenic
1122602476 14:102928553-102928575 GTTCAGGGGCGGGGACTGGAGGG + Intronic
1122848193 14:104512293-104512315 GCTCAGAGGCTGGAAGTTGAGGG + Intronic
1124098657 15:26672614-26672636 GTTCAGGGGCTGGAGGTGGAGGG - Intronic
1124221534 15:27854010-27854032 GGTCAGGAGCTGAGAGTGAATGG - Intronic
1124645790 15:31436829-31436851 GCTCCGGAGCTCCGAGAGGATGG - Intergenic
1125096147 15:35854502-35854524 GCTCTGTGGCTGCTACTGGAGGG + Intergenic
1126765240 15:52004910-52004932 GCTCTGAGGCTGAGCGTGGAAGG + Intronic
1127019987 15:54735841-54735863 GCTCAGGGGCTGTGAGAGGCAGG - Intergenic
1128001238 15:64194263-64194285 GCTCAGGGTTTGCTAGTTGAAGG - Intronic
1129245470 15:74276458-74276480 GCTGTGGGGCTGAGAGAGGAGGG - Intronic
1129330214 15:74823296-74823318 CCCCAGGGGCTGGGAATGGAAGG + Intronic
1130934316 15:88455714-88455736 GCTGAGGGGCTGGGGCTGGAAGG - Intergenic
1131091789 15:89629256-89629278 GTGCAGGGGCTGTGAGTGGCAGG + Intronic
1131431912 15:92394508-92394530 GCGGAGGGGCCGAGAGTGGAGGG + Intronic
1132497703 16:271513-271535 GTTCTGGAGCTGGGAGTGGAGGG - Intronic
1132690530 16:1180104-1180126 GCTGAGGGGCGTCGTGTGGATGG + Intronic
1132696980 16:1206382-1206404 GCTCTGGGGCTGCTGGTGGGAGG - Intronic
1133184207 16:4083829-4083851 GCTTAGGGGCTGCCAGGGGCTGG + Intronic
1136291106 16:29271964-29271986 TCACAGGGGCTGCGGGAGGACGG - Intergenic
1136475444 16:30510347-30510369 GCTATGGGGCTGGGAGTGAAAGG - Exonic
1137295844 16:47092528-47092550 GCTCAGAGGCTGCAGGTGGCTGG + Intronic
1137957990 16:52852564-52852586 GCTCAGGTGCTGACAGTGGTGGG + Intergenic
1139432529 16:66918782-66918804 GGTGAGGGGCTGGGAGTGGAGGG - Exonic
1139958037 16:70702509-70702531 GCTCTGGGGCTGGCAGCGGAGGG + Intronic
1140501077 16:75433865-75433887 GCACAGGAGCTGCGACTAGAAGG - Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141397025 16:83714070-83714092 ACTCTGGGGCAGTGAGTGGAGGG + Intronic
1141635239 16:85310894-85310916 GCTCAGGGGCTGGGGATGGAGGG + Intergenic
1142147144 16:88497426-88497448 GCTCAGGGCCTGGGCGGGGATGG + Intronic
1142158110 16:88542172-88542194 GCTCAGAGGCTGCATGTGGGTGG + Intergenic
1142192605 16:88724896-88724918 GCTCAGGGCCTGGGAGTCGGGGG + Intronic
1142203778 16:88773233-88773255 GCTCAGGGGATCTGAGTAGAGGG + Intronic
1143312935 17:6008182-6008204 GATCAGTGGTTGCCAGTGGATGG - Intronic
1143730552 17:8880486-8880508 GAGCAGGGGCTGGGAGTAGAGGG - Exonic
1144873643 17:18385169-18385191 TCTCAGGGGCTGCGAGCAGCAGG - Intronic
1145158822 17:20560612-20560634 TCTCAGGGGCTGCGAGCAGCAGG + Intergenic
1145263623 17:21368997-21369019 GCCCAGGGGAGGCGAGTGGCTGG + Intergenic
1145283239 17:21483716-21483738 TGCCAGGGGCTGGGAGTGGAGGG + Intergenic
1145394244 17:22482084-22482106 TGCCAGGGGCTGGGAGTGGAGGG - Intergenic
1145898239 17:28473332-28473354 GCTTGGGGGCTGCCTGTGGAGGG + Exonic
1146519482 17:33515192-33515214 GCTCTGGGGTTGGGAGGGGATGG + Intronic
1147259001 17:39197744-39197766 GCGGAGGGGCTGCGAGGGGCGGG - Intergenic
1147259128 17:39198150-39198172 GCTCTGGGGCTGCCGGTGGGAGG + Intergenic
1148134711 17:45284779-45284801 GCTCAGGGGCTGAGTGAAGAGGG - Intronic
1148690636 17:49524976-49524998 GGTGAGGGGCTGGGAGTGGAGGG - Intergenic
1148757496 17:49981236-49981258 GCCAAGGGGCTGGGAGTGGGAGG - Intergenic
1149643259 17:58218982-58219004 TCTTAGAGGCTGTGAGTGGATGG + Intronic
1150466408 17:65396520-65396542 TCTCAGGGAGTGCGAGGGGAGGG + Intergenic
1151428460 17:74046787-74046809 GGCCAGGGGCTGGGAGTGGGAGG - Intergenic
1151787536 17:76282493-76282515 GCTCTGGGGCTGTGAGGGGTGGG + Intronic
1152212499 17:79009818-79009840 GCTCTGCGGCTGCGCGCGGACGG + Intronic
1152524985 17:80883494-80883516 GCTCTGGGGCTGGGGGTGGCTGG - Intronic
1152596469 17:81240045-81240067 GCACAGGGGCTGCAAGTGCCAGG - Intronic
1152654811 17:81514629-81514651 GCTCAGGCCCTGCGGGTGGCGGG - Intronic
1152869244 17:82743180-82743202 GGTCAAGGGCTGCAAGTGGCGGG + Intronic
1153229867 18:2925278-2925300 GCTCAGGGGCTCTGTGGGGATGG + Exonic
1153330284 18:3866779-3866801 GGGCAGGGGCTGGGACTGGAAGG + Intronic
1155068224 18:22287320-22287342 GTTCAGGGGCAGGGAGAGGAAGG - Intergenic
1157335079 18:46732172-46732194 ACTCAGGGGCTGCCAATGGGTGG - Intronic
1157559408 18:48636089-48636111 TCTCAGGGGATGTGAGTGGCAGG + Intronic
1158553249 18:58454984-58455006 GTTGAGGGACTGGGAGTGGATGG + Intergenic
1159798545 18:72869404-72869426 GCGCAGCGGCTGTGAGTGGGTGG + Intergenic
1159892368 18:73964613-73964635 CCTCAGGGACTGTGAGGGGAGGG + Intergenic
1160223736 18:76996694-76996716 GCTGGGGGGCAGGGAGTGGAGGG + Intronic
1160819009 19:1049469-1049491 GCTCACGGGGTGGGAGTGGGGGG - Intronic
1160905478 19:1449956-1449978 GCTCAGGGGCCGTGAGTGCGGGG - Intronic
1160919182 19:1511928-1511950 GCTCCGGGGCAGCCCGTGGAGGG + Intronic
1161026151 19:2038337-2038359 GCTCGGGGGCTGCGCCGGGAAGG + Exonic
1161613117 19:5254719-5254741 GCTCAGAGTCTGAGAGGGGATGG + Intronic
1161664046 19:5564318-5564340 GAGCAGGGGCTACTAGTGGATGG - Intergenic
1161709123 19:5837995-5838017 GCTCTTGGGCTGCCAGTGAAAGG + Intronic
1163477103 19:17532845-17532867 GCTCAGGGACTGAGGGAGGAAGG + Intronic
1164767289 19:30781762-30781784 GCGCGGGGGCTGGGTGTGGACGG - Intergenic
1165074029 19:33270751-33270773 GCTCAGAGGCTGAGAGTGGCAGG - Intergenic
1165328677 19:35128808-35128830 GCTCAGGGGTAGTGAGTGGAGGG - Intronic
1165485844 19:36095468-36095490 GGTCAGGTGGTGTGAGTGGATGG - Intronic
1165860667 19:38907569-38907591 GCTCAGGGGCTCCGTGTGCACGG - Exonic
1166996649 19:46722684-46722706 GCTCAGGGCCTGAGGGTGCAGGG + Intronic
1167369424 19:49071922-49071944 GGCCAGGGGCTGCGAGGGGTGGG - Intronic
1168281539 19:55308672-55308694 GCTCAGGAGCTGTGCCTGGATGG - Exonic
926003900 2:9356660-9356682 GCTGAGAGGCTGCATGTGGATGG + Intronic
932339767 2:70955485-70955507 GCTCAGGGGCTGGGAGAGGGAGG - Intronic
932614026 2:73220572-73220594 GCTCAGGGGCTATTTGTGGAAGG + Intronic
933041539 2:77473594-77473616 GCTCAAGGTCTGTGAGTAGAAGG - Intronic
933983824 2:87574550-87574572 GCTCAGGGGATGCAAGTGAAAGG + Intergenic
935695575 2:105768267-105768289 GCTCAGTGGCCGCGTGTGGCCGG + Intronic
936104858 2:109614914-109614936 GCTCAGGGGCGGCCAGTGCGCGG - Exonic
936310030 2:111376244-111376266 GCTCAGGGGATGCAAGTGAAAGG - Intergenic
937921538 2:127135086-127135108 GCTCAGGGGCGGGGGGTGGGGGG - Intergenic
937931159 2:127205981-127206003 GCTCAGGTGCTCCGGGCGGAGGG - Intronic
940071929 2:149698505-149698527 GCTCAGGGTCTGCCACTGGTAGG - Intergenic
942547121 2:177076702-177076724 GATGAGGGGCTGGGAGTGGAGGG - Intergenic
944811335 2:203329384-203329406 GCTCAAGGGCTGATAGTGGTAGG + Intronic
946334703 2:219029140-219029162 GCTCATGGGCTGGGAGAGGGAGG - Intronic
947523165 2:230863938-230863960 GCTGTTGGGCTGCCAGTGGAGGG - Intergenic
947932675 2:233976528-233976550 TCCCAGGGGCTGCGGGAGGAAGG + Intronic
948111531 2:235460127-235460149 GCTCAGGTGCTGTGAGAGGAAGG - Intergenic
1170024364 20:11872923-11872945 GCTCAGGGGCAGCCTTTGGAAGG - Intergenic
1171186301 20:23126510-23126532 GCTCAGTGGCTGCCTGTGGCTGG + Intergenic
1171448116 20:25218777-25218799 GGCCAGGGCATGCGAGTGGAGGG + Intronic
1171481955 20:25460960-25460982 GCTCAGGGGATGCTTGTGGAGGG - Intronic
1172578837 20:36030853-36030875 GGTCAGAGGCTGTGTGTGGACGG + Intergenic
1175340891 20:58228453-58228475 GGCCAGGGGCTGCGCGGGGAGGG + Exonic
1175529632 20:59665693-59665715 GCAGAGGGGCTGAGAGGGGAGGG + Intronic
1176098626 20:63355124-63355146 GCTCAGGGTCTGGGTGTGGCAGG - Intronic
1176164346 20:63664913-63664935 GGACAGGAGCTGCGAGGGGAAGG - Intronic
1180955511 22:19739588-19739610 CCTCAGGGCCTGCGGGTGGCTGG + Intergenic
1181727619 22:24822409-24822431 GATCAGGGGCTGCCAGGGGTTGG - Intronic
1182058369 22:27378954-27378976 GCCCAGTGGCTGCAGGTGGAGGG - Intergenic
1182612613 22:31561481-31561503 GCTCAGGGCCTGAGAGGGGGTGG + Intronic
1182677489 22:32051005-32051027 GCTCAGGGGCTGAGCTTCGAAGG + Intronic
1183716294 22:39535390-39535412 GCCCAGGGACTGCGTGTAGAGGG + Intergenic
1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG + Intronic
1184172803 22:42769508-42769530 GCCCACCGGCTGCGGGTGGAAGG + Intergenic
1184693342 22:46127324-46127346 GGGTAGGGGCTGCGAGAGGAAGG - Intergenic
1185150399 22:49160791-49160813 GCCCAAAGGCTGCGGGTGGAGGG + Intergenic
1185318921 22:50191283-50191305 GCTCAGGGGCTGGGGGAGCAGGG - Intronic
1185397833 22:50601497-50601519 GGCCTGGAGCTGCGAGTGGAGGG + Intronic
954317383 3:49808460-49808482 GCTCAGGGCCTGTCAGGGGAGGG + Exonic
954693916 3:52410320-52410342 GCCCGGGTGCTGCGAGGGGAGGG + Exonic
956115236 3:65911391-65911413 GCTCTGGGGCTGCTGGTGGAGGG - Intronic
958905349 3:99935955-99935977 GCTGAGGGGCTGCTGGAGGAAGG - Intronic
959671879 3:108987621-108987643 GCTGAGAGGGTGGGAGTGGATGG + Intronic
960985776 3:123279705-123279727 ACTCAGGGAGTGCCAGTGGAGGG + Intergenic
962926097 3:139994655-139994677 GATCAGAGGCTGGCAGTGGAGGG - Intronic
966888374 3:184389014-184389036 GGTCAGCAGCTGTGAGTGGAGGG + Intronic
967120030 3:186374502-186374524 GCTCAGGGACTGAAGGTGGAAGG - Intergenic
968092051 3:195904516-195904538 TCTCAGGGGCTGAGAGAGGAGGG + Intronic
968136048 3:196220215-196220237 GCTCTGAGGCTGGGAGTGGCTGG + Intronic
968496932 4:923671-923693 TCTCAAGGGCAGGGAGTGGAGGG + Intronic
968762435 4:2449618-2449640 GGTCAGCAGCTGCGAGTGGGAGG - Intronic
969058426 4:4416255-4416277 GTTCAGGGGCTGCCACTGGCAGG - Intronic
969446614 4:7248234-7248256 GCTGAGAGGCTGTGTGTGGAGGG + Intronic
969447261 4:7252368-7252390 GCTCAGGGGCCGGCAGTGCATGG + Intronic
969462829 4:7337826-7337848 TCTCAGGAGCTGGGAGTGGCAGG - Intronic
969465248 4:7352586-7352608 GCTCTCGAGCTGGGAGTGGAAGG + Intronic
969584048 4:8081716-8081738 GGTCAGGGGCGGGGAGTGGGAGG + Intronic
969892965 4:10276716-10276738 GCTCAGGGCCCACGAGTGGCAGG - Intergenic
970424848 4:15936565-15936587 GCTCAGGTGCTCCTGGTGGAGGG - Exonic
975689214 4:76948835-76948857 GCGCTGGGGCTGCGGCTGGAGGG - Intergenic
975870564 4:78775643-78775665 GCTCAGGGTGGGCGAGCGGAAGG + Intergenic
979335286 4:119455107-119455129 GCTCAGGTGAGGCGAGTGGGCGG - Intergenic
983499078 4:168479303-168479325 ACTCAGGTGCTGAGAGTTGAGGG - Intronic
985770188 5:1804979-1805001 GATCAGGGGCTGCCAGGGGTTGG - Intronic
986449259 5:7850088-7850110 GATCAGGGGCTGGGAGTCGCGGG - Intronic
988316963 5:29643752-29643774 CCTCAGGGCCTGTGATTGGAGGG - Intergenic
988627457 5:32892992-32893014 GGTCGGGGGGTGCTAGTGGAGGG - Intergenic
990334791 5:54761901-54761923 GCTCAGGGCCTTCCTGTGGATGG - Intergenic
991108866 5:62874922-62874944 GATCAATGGCTGCCAGTGGAGGG + Intergenic
993198583 5:84782421-84782443 GCTCAGGGCCTGTGATGGGAGGG + Intergenic
1002168613 5:177362966-177362988 GCTCAGGGTGTGCGCGAGGAGGG + Intronic
1002168931 5:177364504-177364526 GCTCAGGGTGTGCGCGAGGAGGG - Intronic
1002417889 5:179130304-179130326 GGGCAGAGGATGCGAGTGGAGGG - Intronic
1002437115 5:179238464-179238486 GCACAGGGTCTGCGAGTGCCAGG + Intronic
1003078003 6:2999643-2999665 CCTCAGGGGCGGGGAGTGGGCGG + Intronic
1003276988 6:4661553-4661575 GCTCAGGGCCTGCATGTGGCTGG - Intergenic
1003995739 6:11537991-11538013 GCTCGGGGGCCGCGCGAGGACGG + Intergenic
1004074460 6:12332309-12332331 GCTCAAGGGATGGGAGTGGGTGG + Intergenic
1006809218 6:36809175-36809197 GCGTAGGGGCTGCAAGGGGAGGG - Intronic
1011385827 6:86796710-86796732 CCTCTGGGGCTGTGATTGGAAGG + Intergenic
1013892496 6:115042097-115042119 GCTCAGGGGCTAGGAGTAAAGGG + Intergenic
1014150101 6:118044518-118044540 GCTCAGAGGCTGTGACTGGGAGG + Intronic
1014805111 6:125820730-125820752 GCTCATGGGCTGAAAGTGGGAGG - Intronic
1015867813 6:137745088-137745110 GCAAAGGGGCTGCAAGAGGAGGG - Intergenic
1016564330 6:145436115-145436137 GATCAGTGGCTGCCAGTGGTTGG - Intergenic
1018364971 6:163110686-163110708 GCCCAGGGGCTGCTAGAGGAAGG - Intronic
1018697945 6:166405395-166405417 GCTCAGGGGGTGAGGGTGGGAGG - Intergenic
1018787532 6:167119908-167119930 GCACAGGTGCTGAGAGTGGAGGG - Intergenic
1019172819 6:170143814-170143836 GAACTGGGGCTGCGAGGGGAAGG + Intergenic
1019372706 7:671273-671295 GCTCACGGGCTGCCTCTGGAGGG + Intronic
1019521470 7:1462385-1462407 GTGCAGGGGCTGCGGGAGGAAGG + Intergenic
1022410770 7:30136639-30136661 CCTCAGGGGGTGCGTGTGGGCGG - Intronic
1023590915 7:41779698-41779720 GCACAGGGGATGTGAGTGGATGG - Intergenic
1023835170 7:44063692-44063714 GCTCAGGGGCTGCAGGAGGCAGG - Intronic
1024295364 7:47837442-47837464 GCTCAGGAGGTGCCAGAGGAAGG - Intronic
1024964399 7:55009387-55009409 GATCAGTGGCTGCCAGTGGTTGG - Intergenic
1029149740 7:98471212-98471234 CCTCAGGGCCTGCGGGAGGAGGG + Intergenic
1029306726 7:99625107-99625129 GGTCAGGGTCAGCAAGTGGAGGG - Intronic
1030121125 7:106112002-106112024 GCCCCGGGACTGGGAGTGGACGG - Intronic
1031139933 7:117931529-117931551 GGTCAGGGGCTCAGAGAGGAGGG - Intergenic
1033232009 7:139606629-139606651 GCTTTGGGGCGGGGAGTGGAGGG - Intronic
1034441784 7:151089352-151089374 GCCCTGGGGCTGGGGGTGGAGGG - Intronic
1034478696 7:151303585-151303607 GCGCAGGGGCTGCGGCTGGGCGG + Intergenic
1034570897 7:151955563-151955585 CTTCAGGGTCTGTGAGTGGAAGG - Intergenic
1034893250 7:154858788-154858810 GCTAAGGGGCTGCCATTAGAGGG - Intronic
1036193662 8:6694821-6694843 ACTCAAGGGCTCCGAGTAGACGG - Intergenic
1036648723 8:10628474-10628496 TCTCTGGGGCTGGGGGTGGAGGG - Intronic
1037751020 8:21682517-21682539 GTTCAGGGGCTTTGGGTGGATGG + Intergenic
1038845396 8:31224393-31224415 GCTCATTGGCTGAGAGTGGATGG + Intergenic
1040823333 8:51589991-51590013 GCTCAGGGCCTGCGATGGGAAGG - Intronic
1040845235 8:51830631-51830653 GCTCATTGGCTGCCTGTGGAGGG - Intronic
1048103222 8:131378302-131378324 CCTCAGGGGATGAGAGTGGAGGG + Intergenic
1048157805 8:131977353-131977375 GCCCAGAGACTGTGAGTGGAAGG + Intronic
1048474697 8:134732784-134732806 GATCAGGGGCTGCCAGGGGCTGG + Intergenic
1048878570 8:138855587-138855609 GCACAGGGGTTGTGAGTAGAAGG - Intronic
1049097521 8:140557756-140557778 GCACGGGGGCTGCTAGTGCAGGG + Intronic
1049423352 8:142526472-142526494 GCTCAGGGGCTGACACTGGCCGG - Intronic
1050658369 9:7854565-7854587 GCTTGGGGGCTGCGGGTGGGGGG - Intronic
1053303558 9:36968675-36968697 GGTCATGGGCTGCCAGAGGAGGG - Intronic
1054731593 9:68706316-68706338 GGGCAGGGGCTGGGAGTGTAGGG + Intronic
1055694637 9:78870651-78870673 GCTCAGGGGCTTCCAGGGGGTGG + Intergenic
1056905391 9:90642959-90642981 GTGCAGGGGCTGCGAGCGGGTGG - Exonic
1057230598 9:93319336-93319358 GCTGAGGGGCTGCGGGTGCTGGG + Intronic
1057992608 9:99786380-99786402 GCTCAGAGGCTGCCAGAGGAGGG - Intergenic
1059140842 9:111851794-111851816 GCCCAGGGGGAGAGAGTGGATGG - Intergenic
1060829757 9:126706109-126706131 GCTCAGGGGATGGGGGTGGGAGG - Intergenic
1060995569 9:127873483-127873505 GCCCAGGGCCTGAGAGGGGAAGG - Intronic
1061085137 9:128393853-128393875 GCCCAGGGGCTTCCACTGGAGGG + Intergenic
1061415208 9:130443902-130443924 GCAGAGGGGCTGAGAGTGGATGG + Intergenic
1061791466 9:133061404-133061426 GCTCAGGGGGTGTGGGTGGGGGG - Intergenic
1061795140 9:133081971-133081993 GCTCAGGGGGTGTGGGTGGGGGG - Intronic
1061886959 9:133596019-133596041 GCTCTGTGGCTGCGGGTGCAAGG + Intergenic
1062379459 9:136280317-136280339 GCTCAGAGGGTGTGTGTGGAAGG + Intergenic
1062474336 9:136719896-136719918 GATCTGGGGCTCCGAGTGCAGGG + Intronic
1062577652 9:137216026-137216048 GCTCAGGGGCTGGGAAAGGAGGG + Intronic
1186256564 X:7728124-7728146 GCACAGCGGCTGCCAGTGGGTGG - Intergenic
1186493388 X:9992792-9992814 GCCCAGGGGCTGGGAGTGGGCGG + Intergenic
1189777689 X:44484877-44484899 GCTTAGGAGCAGCTAGTGGAGGG - Intergenic
1189856548 X:45229848-45229870 GCTCGTGGGCTGGGAGTGGGTGG - Intergenic
1192180891 X:68914851-68914873 GCTGAGGAGCTGCGAGTGGGGGG + Intergenic
1192503088 X:71665853-71665875 GCTCAGGAGCTGCCACTGCAGGG - Intergenic
1192529415 X:71872372-71872394 GCTCAGGAGCTGCCGCTGGAGGG - Intergenic
1194220034 X:91178288-91178310 GCTCAGCTACTGCCAGTGGATGG + Intergenic
1196807862 X:119605190-119605212 GCTAGGGGGCTGCAAGTAGAGGG + Intronic
1197672915 X:129298524-129298546 GCTCTGGGCCTGTGATTGGAGGG - Intergenic
1198212333 X:134528212-134528234 GCTCAGGTCCTGCAAGTGCAGGG + Intergenic
1198568960 X:137935028-137935050 CCTCAGGGCCTGCGATAGGAGGG - Intergenic
1199364021 X:146957222-146957244 AGTCAGGGGCTCCGAATGGAGGG + Intergenic
1200088891 X:153625329-153625351 GCTCCAGGGCAGTGAGTGGAAGG - Intergenic
1200124501 X:153806937-153806959 GCTGAGGGGCTGCGGGCTGAGGG - Intronic
1200239313 X:154485672-154485694 ATTCAGGGGCTGCCAGTGGTGGG + Intronic
1200556545 Y:4642049-4642071 GCTCAGCTACTGCCAGTGGATGG + Intergenic