ID: 1184100318

View in Genome Browser
Species Human (GRCh38)
Location 22:42338508-42338530
Sequence CTCAGGGGCTGCGAGTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 267}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100299_1184100318 29 Left 1184100299 22:42338456-42338478 CCTCCCGGCAGCCCGGCCTGCAG 0: 1
1: 0
2: 5
3: 36
4: 395
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 267
1184100309_1184100318 3 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 267
1184100308_1184100318 13 Left 1184100308 22:42338472-42338494 CCTGCAGGGGCCACTCGGCCAAT 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 267
1184100305_1184100318 18 Left 1184100305 22:42338467-42338489 CCCGGCCTGCAGGGGCCACTCGG 0: 1
1: 0
2: 2
3: 44
4: 302
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 267
1184100314_1184100318 -10 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 267
1184100302_1184100318 26 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG 0: 1
1: 0
2: 4
3: 43
4: 438
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 267
1184100310_1184100318 -5 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 267
1184100304_1184100318 25 Left 1184100304 22:42338460-42338482 CCGGCAGCCCGGCCTGCAGGGGC No data
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 267
1184100307_1184100318 17 Left 1184100307 22:42338468-42338490 CCGGCCTGCAGGGGCCACTCGGC 0: 1
1: 0
2: 3
3: 27
4: 248
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 267
1184100298_1184100318 30 Left 1184100298 22:42338455-42338477 CCCTCCCGGCAGCCCGGCCTGCA 0: 1
1: 0
2: 5
3: 28
4: 316
Right 1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100318 Original CRISPR CTCAGGGGCTGCGAGTGGAA GGG Intronic
900546016 1:3229620-3229642 CTCATGGGCTGCAAGTGGCTGGG - Intronic
900624813 1:3603292-3603314 CTCAGGCCCTGCGGGGGGAAGGG + Intronic
901866910 1:12112358-12112380 CATAGGGGCAGCGAGTGGAGTGG - Intronic
902265187 1:15258231-15258253 CTGGGGGGCTGGGAGGGGAAGGG - Intronic
902608771 1:17584719-17584741 CCCTGGGGCTGCGGGTGCAAAGG + Intronic
902621956 1:17655958-17655980 CACAGGGGCTGCCAGTGGGAAGG - Exonic
903358009 1:22759909-22759931 GTCAGGGGAGGCGAGTGGAGAGG + Intronic
905863094 1:41363144-41363166 CTCAGTGCCAGCCAGTGGAAAGG + Intronic
907762599 1:57376232-57376254 ACCAGGGACTGGGAGTGGAAAGG - Intronic
908454120 1:64285217-64285239 CTCAGAAGCTGAGAGCGGAATGG - Intergenic
908792028 1:67792238-67792260 CTCAGGCACTGGGAGTGCAACGG - Intronic
909938294 1:81580353-81580375 CTCGGGGGCTGCCTGTGAAAGGG + Intronic
910508478 1:87977321-87977343 CTCTGGTGCTGCCAGGGGAAAGG - Intergenic
913061071 1:115208663-115208685 CCCATGGGCTGCGAGTTGGATGG + Intergenic
915340780 1:155175571-155175593 GGCGGGGGCTGCGGGTGGAAGGG - Exonic
915629692 1:157142634-157142656 CTCCTGGGCTGCCAGTGGGAAGG - Intergenic
917434121 1:175001488-175001510 GTCAGGGGCTGAGGGAGGAATGG - Intronic
917501946 1:175593679-175593701 CTCTGGGGCTGCTAGTGACAGGG - Intronic
917733877 1:177902658-177902680 CTCATGGGCAGAGAGAGGAAAGG + Intergenic
920459094 1:206124545-206124567 GTCAGGAGCTGGGAGTGGGAGGG - Intergenic
922131174 1:222780343-222780365 CTCAGGGGCAGAAAGTAGAATGG - Intergenic
922236560 1:223726755-223726777 ATCAGGGGCTGGGAGGGGAGGGG - Intronic
1063224539 10:4003450-4003472 CTGGGGGGCTGCGTGTGGAGAGG + Intergenic
1064555050 10:16539561-16539583 CTCAGGAGCATCGAGTGGAAAGG - Intergenic
1065873215 10:29974013-29974035 CTGAGGGGCTGGGTGTGGCATGG - Intergenic
1066174424 10:32888729-32888751 AACAGGGGCTGCGTGTGGAGGGG - Intergenic
1066459106 10:35597726-35597748 CTGAGGGGCAGTGAGTGCAAAGG + Intergenic
1067406943 10:46031851-46031873 GTCATAGGCTGTGAGTGGAAGGG + Intergenic
1067660569 10:48233865-48233887 CTCAGGGGCTGGTGGAGGAAAGG + Intronic
1068184158 10:53564008-53564030 CTCTGGGCCTGCGATAGGAAGGG - Intergenic
1069152047 10:64974973-64974995 CTCACTGGCAGAGAGTGGAATGG + Intergenic
1069574517 10:69517180-69517202 CACAGGAGCAGCGAGAGGAAGGG - Intergenic
1069864550 10:71493550-71493572 CTCAAAGGATGCCAGTGGAATGG - Intronic
1073447381 10:103589727-103589749 GTCCGGGGCTGGGAGTGGAGAGG + Intronic
1076365002 10:129916048-129916070 CACAGGGGCTCCGAGGGGGAAGG + Intronic
1076835029 10:133016711-133016733 CTCAGGGGCTGGCAGTGGGGAGG - Intergenic
1077107313 11:847858-847880 CTCTGTGGCTGGGGGTGGAAGGG - Intronic
1083209867 11:61176536-61176558 ATCAGGGCCTGGAAGTGGAAAGG - Intergenic
1083297322 11:61722021-61722043 CTCAGGGGCTGAGACTGGAGGGG - Intronic
1084178927 11:67437154-67437176 CTCAGGGACTGGGAGTGGAACGG - Intronic
1084644755 11:70449335-70449357 GTCAGGGGCTGGGAGAAGAAGGG + Intergenic
1085930347 11:81074989-81075011 CTCAGAAGCAGAGAGTGGAATGG - Intergenic
1087728840 11:101755769-101755791 CTCAGTGACTCCGAATGGAAAGG - Intronic
1089097993 11:115935675-115935697 CTCAGGAGGTCCCAGTGGAATGG + Intergenic
1089127853 11:116190023-116190045 CTCAGGAGCTGGGGGTGGAGGGG + Intergenic
1089530067 11:119121850-119121872 CTGCGGGACTGCGAGTGGAGAGG + Intronic
1090111812 11:123919262-123919284 CTCAGGGGCAAAGAGTCGAAGGG - Intergenic
1091974568 12:4814059-4814081 CTTAGGGGCTGGGAGTGCCAGGG + Intronic
1092226026 12:6748872-6748894 CTCAGGGGCTGGGGGACGAAGGG - Exonic
1096718918 12:53506973-53506995 GGCAGGGGCTGGGGGTGGAAAGG - Intronic
1098272450 12:68781909-68781931 CTGAGGGGCTTCGAGGAGAAAGG - Intronic
1100704142 12:97181974-97181996 GTCAGGGGCTGTGGGGGGAAAGG - Intergenic
1101535681 12:105614177-105614199 CTCAGAGGCAGAAAGTGGAATGG - Intergenic
1101875150 12:108592513-108592535 CTCAGGCCCTGGGAATGGAAGGG - Intronic
1101880729 12:108623798-108623820 CTCTGTGGCTGCCAGTGGAGTGG + Exonic
1101880738 12:108623858-108623880 CTCTGTGGCTGCCAGTGGAGTGG + Exonic
1103182538 12:118926179-118926201 GGCAGGGGCTGAGAGAGGAAAGG + Intergenic
1103567780 12:121825483-121825505 CACAGAGGGTGCAAGTGGAAGGG + Intronic
1104349909 12:128036011-128036033 CGCAGGTGCTGAGAGTGGACAGG - Intergenic
1104669144 12:130668456-130668478 CTGAGGAGCTGCGAGGGCAATGG + Intronic
1104736383 12:131138212-131138234 CTCACGAGGTCCGAGTGGAAGGG - Exonic
1104761504 12:131299777-131299799 CTGAGGGGCTGCGGGTGGGAAGG + Intergenic
1104818272 12:131661015-131661037 CTGAGGGGCTGCGGGTGGGAAGG - Intergenic
1110692124 13:78443044-78443066 CTTAGGGGCTGTGGGTGGAGCGG - Intergenic
1110767310 13:79295436-79295458 CTCAGGGGCTAAGAATGGAAGGG - Intergenic
1113864464 13:113512086-113512108 CTCAGGGGCCGGGACTGGAGAGG + Intronic
1113864514 13:113512307-113512329 CTCAGGGGCCGGGACTGGAGAGG + Intronic
1113864581 13:113512634-113512656 CCCAGGTGCTGGGACTGGAAGGG + Intronic
1113864609 13:113512770-113512792 CCCAGGTGCTGGGACTGGAAGGG + Intronic
1113864626 13:113512838-113512860 CCCAGGTGCTGGGACTGGAAGGG + Intronic
1115345326 14:32336856-32336878 CTCAGGGGCTGCTGGTGGGGAGG - Intronic
1115893860 14:38061803-38061825 CTCTGGGGCTGTGATGGGAAGGG + Intergenic
1117751724 14:58930397-58930419 CTCAGGGCCTGTGATGGGAAGGG + Intergenic
1118919208 14:70134409-70134431 GTTAGGGACTGCGAGTGGTATGG - Intronic
1119199999 14:72745083-72745105 CTCAGGGGGTGGGTGTGGAGGGG + Intronic
1120079102 14:80195459-80195481 GCCAGGGGCTGGGAGTGGCAAGG + Intergenic
1121564695 14:94900462-94900484 GCCAGGGGCTGGGAGTGGACGGG + Intergenic
1121651758 14:95564044-95564066 CTCATGGGCAGGGAGTGGTAGGG + Intergenic
1124101892 15:26703413-26703435 CTCAGGTGCTGCCAATGGATAGG - Intronic
1124213905 15:27790598-27790620 GCCAGGGGCTGAAAGTGGAAAGG + Intronic
1125522736 15:40357302-40357324 CTGGGGGGCTGGGAGTGGAGAGG - Intergenic
1125752771 15:42041359-42041381 ATCGGTGGGTGCGAGTGGAATGG - Intronic
1125888625 15:43249060-43249082 CCCAGGGGCTGTAAGGGGAAGGG - Intronic
1126239347 15:46424057-46424079 ATAAGGGGGTACGAGTGGAATGG + Intergenic
1126693146 15:51303320-51303342 CTAAGGGGCTATGATTGGAAGGG - Intronic
1126765241 15:52004911-52004933 CTCTGAGGCTGAGCGTGGAAGGG + Intronic
1127579316 15:60323021-60323043 CTCAGGGGCGGGGGGTGGAGTGG - Intergenic
1128001237 15:64194262-64194284 CTCAGGGTTTGCTAGTTGAAGGG - Intronic
1128920096 15:71602704-71602726 GCCAGGGGCTGGGAGTAGAAGGG + Intronic
1129159239 15:73738042-73738064 CACAGGGGCTTTGAGTGGGATGG - Exonic
1131091790 15:89629257-89629279 TGCAGGGGCTGTGAGTGGCAGGG + Intronic
1131734710 15:95319822-95319844 CTTAGAGGCTGAGAGTAGAATGG - Intergenic
1132696979 16:1206381-1206403 CTCTGGGGCTGCTGGTGGGAGGG - Intronic
1133013949 16:2930398-2930420 CTGAGGGGCTGCTGGGGGAACGG - Exonic
1134114429 16:11537483-11537505 GCCAGGGGCTGGGAGTGGCAGGG + Intergenic
1136684179 16:31984357-31984379 CTCAGGGTCTTGGGGTGGAAGGG + Intergenic
1136784807 16:32927909-32927931 CTCAGGGTCTTGGGGTGGAAGGG + Intergenic
1136884976 16:33925897-33925919 CTCAGGGTCTTGGGGTGGAAGGG - Intergenic
1137667079 16:50257262-50257284 CTCAGAAGCAGCAAGTGGAAGGG + Intronic
1139432528 16:66918781-66918803 GTGAGGGGCTGGGAGTGGAGGGG - Intronic
1141255801 16:82401492-82401514 CTTGGGGGCTACGAGAGGAAGGG - Intergenic
1141306137 16:82865639-82865661 CTCAGGGCCTGTGATGGGAAGGG + Intronic
1141397026 16:83714071-83714093 CTCTGGGGCAGTGAGTGGAGGGG + Intronic
1141514504 16:84534872-84534894 TGCTGGGGCTCCGAGTGGAAGGG - Intronic
1141635240 16:85310895-85310917 CTCAGGGGCTGGGGATGGAGGGG + Intergenic
1203087468 16_KI270728v1_random:1191915-1191937 CTCAGGGTCTTGGGGTGGAAGGG + Intergenic
1143400549 17:6639850-6639872 CCCCGGGGCTGCGAGAGAAAAGG - Intronic
1144669895 17:17127035-17127057 CCCAGAGGCTGCAGGTGGAATGG - Intronic
1144750802 17:17646999-17647021 TTCAGGGGCTGAGAGGGGGAAGG + Intergenic
1145283240 17:21483717-21483739 GCCAGGGGCTGGGAGTGGAGGGG + Intergenic
1145394243 17:22482083-22482105 GCCAGGGGCTGGGAGTGGAGGGG - Intergenic
1146562513 17:33883503-33883525 CTTAGGGGCAGCCTGTGGAAAGG - Intronic
1147145116 17:38480051-38480073 CTCAGGGTCTCGGGGTGGAAGGG + Intronic
1147988693 17:44320609-44320631 CTCAGGGACGGTGAGTGGACTGG - Exonic
1148690635 17:49524975-49524997 GTGAGGGGCTGGGAGTGGAGGGG - Intergenic
1148757494 17:49981235-49981257 CCAAGGGGCTGGGAGTGGGAGGG - Intergenic
1148795793 17:50196113-50196135 CTCAGGGCCTGGGAGTGGGGAGG - Intronic
1149643260 17:58218983-58219005 CTTAGAGGCTGTGAGTGGATGGG + Intronic
1151183695 17:72348574-72348596 CTCAGGGGATGGGATTGGGACGG + Intergenic
1151464769 17:74277463-74277485 CTCTGGGGCTAGGAGTGGGATGG + Intronic
1151536963 17:74744629-74744651 GTCAGGGGCTAAGAGTGCAAAGG + Intronic
1151668481 17:75558768-75558790 CTCAGGTGCTCCGAGTGGAGTGG + Intronic
1151903977 17:77035781-77035803 CTTTGGGGATGGGAGTGGAAAGG + Intergenic
1152596468 17:81240044-81240066 CACAGGGGCTGCAAGTGCCAGGG - Intronic
1154203693 18:12319039-12319061 CTCAGGGGCCACCAGTAGAAGGG - Intronic
1154425229 18:14267090-14267112 CTCAGGGCCTGCGATAGCAAGGG - Intergenic
1156793810 18:41014974-41014996 CTTGGGGGCTGGGAGTGGGATGG + Intergenic
1157559409 18:48636090-48636112 CTCAGGGGATGTGAGTGGCAGGG + Intronic
1158783426 18:60679598-60679620 CTCAGGGGTTGGGGGTGGGATGG - Intergenic
1159892369 18:73964614-73964636 CTCAGGGACTGTGAGGGGAGGGG + Intergenic
1161026152 19:2038338-2038360 CTCGGGGGCTGCGCCGGGAAGGG + Exonic
1161717439 19:5884534-5884556 GTCAGGGGCTGGGGGAGGAAGGG + Intronic
1162489893 19:10985833-10985855 CTCAGGGGCTGCACTGGGAATGG + Intronic
1163371143 19:16901959-16901981 CTGATGGGCTGCGAGTGTCATGG + Intronic
1163439511 19:17314610-17314632 CCCAGGGGCTGGGAGTGGACAGG - Intronic
1163477104 19:17532846-17532868 CTCAGGGACTGAGGGAGGAAGGG + Intronic
1163738667 19:18997284-18997306 GCCAGGGGCTGGGAGAGGAAAGG + Intronic
1163785847 19:19274574-19274596 CTAAGGGGCTGCGTGCAGAATGG - Intergenic
1165144706 19:33723928-33723950 CACAGGGGCTGAGAGTGGGGAGG + Intronic
1166140036 19:40800582-40800604 CTTAGGGGCTGCGGCTGGCACGG - Exonic
1166165419 19:40984359-40984381 CTCAGGTTCTGACAGTGGAATGG - Intergenic
1166347772 19:42177029-42177051 GGCAGGGGCTGCGAGGGGAGAGG + Intronic
1166869516 19:45863072-45863094 CTGAGGGGGCGCGAGGGGAACGG - Exonic
1166966093 19:46530120-46530142 CTAAGGAGCTGGGGGTGGAAGGG - Intronic
1167299029 19:48668652-48668674 CACAGTGGCTGCGTGTGGCAGGG - Intronic
1168348386 19:55661708-55661730 CTCAGGGGGTGCCACAGGAAGGG - Intronic
926490978 2:13526105-13526127 CTCAGGGGGTGCGTGTGAGAGGG + Intergenic
926713446 2:15902883-15902905 ACCAGGGGCTGGGAGTGGAAAGG + Intergenic
927917838 2:26948007-26948029 ATCAGGGGCAGAGAGGGGAAAGG - Exonic
928728670 2:34205876-34205898 CTCAGGGAGTGTGAGTGGACTGG + Intergenic
930718901 2:54619924-54619946 GTCAGGGGCGGCGATAGGAATGG + Intronic
931121520 2:59225561-59225583 CTCTGGGGTTGGGATTGGAAAGG - Intergenic
932337231 2:70938234-70938256 CTCAGGCTCTGGGAGTGGGAGGG + Intronic
933653941 2:84872025-84872047 CTCAGGGGCCAGGAGTGAAATGG - Intronic
933983825 2:87574551-87574573 CTCAGGGGATGCAAGTGAAAGGG + Intergenic
935180731 2:100689032-100689054 CTCAGGGGCAAAGGGTGGAAAGG + Intergenic
936310029 2:111376243-111376265 CTCAGGGGATGCAAGTGAAAGGG - Intergenic
939161053 2:138589302-138589324 GTCAGGGGGTGGGAGTGGCAGGG + Intergenic
940071928 2:149698504-149698526 CTCAGGGTCTGCCACTGGTAGGG - Intergenic
940215755 2:151301773-151301795 CACAGGGGTAGAGAGTGGAATGG + Intergenic
944502648 2:200377966-200377988 CTCAGGGGCAGTGAGTGTAAAGG + Intronic
944811336 2:203329385-203329407 CTCAAGGGCTGATAGTGGTAGGG + Intronic
944817966 2:203398713-203398735 ACCAGGAGCTGGGAGTGGAAGGG - Intronic
945939276 2:215932188-215932210 CTCAGCAGCTGGGAGTGGCACGG - Intergenic
947932677 2:233976529-233976551 CCCAGGGGCTGCGGGAGGAAGGG + Intronic
948111530 2:235460126-235460148 CTCAGGTGCTGTGAGAGGAAGGG - Intergenic
948868201 2:240785799-240785821 CTCAGGAGCTGAGAGTGACAAGG + Intronic
1170836138 20:19886238-19886260 CTCAGTGGCTGTCAGTAGAATGG + Intergenic
1171464688 20:25319291-25319313 CTCCAGGGCAGCCAGTGGAAAGG + Intronic
1171481954 20:25460959-25460981 CTCAGGGGATGCTTGTGGAGGGG - Intronic
1173614061 20:44391217-44391239 CTCAGGTGGTGCGGGTGGCAGGG - Intronic
1174406831 20:50308453-50308475 CTCAGGGTCTGAGAAGGGAAGGG - Intergenic
1175691388 20:61068242-61068264 CTCAGGGCATGTGAGGGGAACGG - Intergenic
1176074361 20:63241745-63241767 CTGTGGGGCTGGGAGTGGAGAGG + Intronic
1176098625 20:63355123-63355145 CTCAGGGTCTGGGTGTGGCAGGG - Intronic
1176164345 20:63664912-63664934 GACAGGAGCTGCGAGGGGAAGGG - Intronic
1177297878 21:19200798-19200820 ATCAGTGGTTGCCAGTGGAAGGG - Intergenic
1178702427 21:34844896-34844918 CTCAGGAGCTGTGAGTGGCCAGG - Intronic
1180977604 22:19857395-19857417 ACCAGGGGTTGCGAGTGGGAGGG - Intergenic
1181270356 22:21654952-21654974 CTCAGGGGCTCCCAGTCTAATGG - Intronic
1182677490 22:32051006-32051028 CTCAGGGGCTGAGCTTCGAAGGG + Intronic
1183508550 22:38222276-38222298 CTCAGGGGCTCAGAGCAGAAAGG + Intronic
1184100318 22:42338508-42338530 CTCAGGGGCTGCGAGTGGAAGGG + Intronic
1184238304 22:43198277-43198299 CTCAGGGGCTCTGAGTGGCATGG + Exonic
1184693341 22:46127323-46127345 GGTAGGGGCTGCGAGAGGAAGGG - Intergenic
1185215949 22:49600102-49600124 CCCGGGGGCTGGGAGTGGTAAGG - Intronic
1185299447 22:50071974-50071996 CTGAGGGGCTGCCAGTGCAAAGG + Intronic
949128110 3:470762-470784 CTCTGGGCCTGTGATTGGAAGGG - Intergenic
954464297 3:50645695-50645717 CTCAGGGGCTGCCAGGGCAGAGG - Exonic
962198842 3:133385106-133385128 TTCAGGGCCTGTGAGTGAAAAGG - Intronic
963264204 3:143223181-143223203 CTGAGGGGCTGTGACTGAAAGGG - Intergenic
963904388 3:150762352-150762374 CTCCGGGCCTGCGAGTGGGCTGG + Intronic
967120029 3:186374501-186374523 CTCAGGGACTGAAGGTGGAAGGG - Intergenic
968496933 4:923672-923694 CTCAAGGGCAGGGAGTGGAGGGG + Intronic
968762434 4:2449617-2449639 GTCAGCAGCTGCGAGTGGGAGGG - Intronic
969462828 4:7337825-7337847 CTCAGGAGCTGGGAGTGGCAGGG - Intronic
969892964 4:10276715-10276737 CTCAGGGCCCACGAGTGGCAGGG - Intergenic
970695743 4:18674952-18674974 CACAGGGGATGCTACTGGAAGGG + Intergenic
976430818 4:84962471-84962493 TTCAGGGGCTGGGAGTGTAGAGG + Intronic
976460038 4:85300600-85300622 ATCAGAGGCTGAGCGTGGAAAGG - Intergenic
978042619 4:104088140-104088162 GCCAGGGGCTGGGAGTGGCAGGG - Intergenic
978153373 4:105463601-105463623 CTCAGGGCCTGTGATGGGAAGGG - Intronic
984599419 4:181709542-181709564 CTGAGGGACTGCAAGTGCAAAGG + Intergenic
985939271 5:3121515-3121537 CTCAGGGGCTGCCGCTGGACTGG + Intergenic
988316962 5:29643751-29643773 CTCAGGGCCTGTGATTGGAGGGG - Intergenic
988729793 5:33960601-33960623 CTCAGGGGGTAAGTGTGGAAAGG + Intronic
989645621 5:43629155-43629177 CTCAGGGGTTAAGAGTGGGAGGG - Intronic
990605995 5:57410727-57410749 CTCAGGGTTTTCGAGTGGGAGGG + Intergenic
990988398 5:61661890-61661912 GTCAGGGGCAGCGGGTTGAAGGG + Intronic
991204789 5:64038437-64038459 CTCTGGGTCTGTGATTGGAAGGG - Intergenic
991666903 5:69008360-69008382 GTGAGGGGGTGGGAGTGGAAGGG - Intergenic
993384929 5:87252127-87252149 CTCTGAGCCTGCGAGGGGAAGGG + Intergenic
993621301 5:90171165-90171187 CTCACAGGATGTGAGTGGAAAGG + Intergenic
996865638 5:128118553-128118575 CTTTGGGGATGCGGGTGGAAGGG + Intronic
997980234 5:138464243-138464265 GTCCGGGGCTGGGAGTGGAGAGG + Intergenic
998725431 5:145007747-145007769 CTCAGAAGCTGCGAGTAGAATGG + Intergenic
998957803 5:147454438-147454460 CTCAGAGGCTGCAAGGGGCACGG + Intronic
999643919 5:153699537-153699559 CTTAGGGGTGGAGAGTGGAAGGG - Intronic
1000198651 5:158986117-158986139 GACAGGGGCTGGGAGCGGAATGG - Intronic
1001095547 5:168772937-168772959 CTAAGTGGCTGCGAGAGGGATGG + Exonic
1001373697 5:171233715-171233737 CTCAGTGGCTGCCAGTGGTTAGG + Intronic
1001455221 5:171855084-171855106 CACACGGGCTGAGAATGGAAGGG - Intergenic
1002375998 5:178789553-178789575 CTCATGGGCTGGTAGTGGGAGGG - Intergenic
1002437116 5:179238465-179238487 CACAGGGTCTGCGAGTGCCAGGG + Intronic
1003585793 6:7388140-7388162 CTCCAGAGCTGAGAGTGGAAAGG + Intronic
1005973391 6:30778861-30778883 CCCAGGGCCTGCAAGTGGACAGG + Intergenic
1006187121 6:32187898-32187920 CTCAGGGTCTTGGAGAGGAATGG + Intronic
1006535547 6:34696387-34696409 CTCGGGGGCCCCGAGGGGAAGGG - Intronic
1007068538 6:39017480-39017502 CACAGGGGCTGCTAATGAAATGG + Intronic
1011385828 6:86796711-86796733 CTCTGGGGCTGTGATTGGAAGGG + Intergenic
1015340270 6:132091010-132091032 CTAAGGGGCTGAGAGAGGAATGG + Intergenic
1016057779 6:139596727-139596749 TTCAGGGTCTGTGAGAGGAAGGG + Intergenic
1016225078 6:141724894-141724916 GTCAGGGGGTGGGAGTGGGAGGG + Intergenic
1018063739 6:160110875-160110897 CTCAGAAGCAGAGAGTGGAATGG + Intronic
1018697944 6:166405394-166405416 CTCAGGGGGTGAGGGTGGGAGGG - Intergenic
1019172820 6:170143815-170143837 AACTGGGGCTGCGAGGGGAAGGG + Intergenic
1019457435 7:1137934-1137956 CTCAGCGCGGGCGAGTGGAAGGG - Exonic
1019521471 7:1462386-1462408 TGCAGGGGCTGCGGGAGGAAGGG + Intergenic
1020783287 7:12542376-12542398 CTCAGGTTATGCGAGTAGAAAGG + Intergenic
1021940692 7:25676165-25676187 CTCAGAAGCTGGGTGTGGAAAGG - Intergenic
1022019563 7:26385307-26385329 CACAGGGACTGAGAGTGGAGAGG - Intergenic
1022101809 7:27173567-27173589 CCCGGGGGCTGCGCGGGGAACGG + Exonic
1023602010 7:41889553-41889575 ATCAGGAGATGGGAGTGGAAGGG - Intergenic
1026482268 7:70789667-70789689 GCCAGGGGCTGCGGGTGAAATGG - Intronic
1028487259 7:91373592-91373614 CTGTGGGCCTGGGAGTGGAAAGG - Intergenic
1030940795 7:115646908-115646930 CTCAGAAGCAGAGAGTGGAATGG - Intergenic
1031195503 7:118609082-118609104 CTCAGGGGCTTTGAGTGGGCAGG + Intergenic
1031286778 7:119880333-119880355 CTCAGGAACTGAGAGAGGAAAGG - Intergenic
1033255486 7:139797673-139797695 GTGAGGGGCTGGGAGTGGGATGG + Intronic
1033451175 7:141463556-141463578 CTCAGGAGCTGCCACTGGGAAGG - Intronic
1034210089 7:149355918-149355940 CTCAGGAACTGAGAGTGGAGAGG - Intergenic
1034570896 7:151955562-151955584 TTCAGGGTCTGTGAGTGGAAGGG - Intergenic
1036112773 8:5922387-5922409 GTCTGGGGCTGGGAGTGAAATGG + Intergenic
1036193661 8:6694820-6694842 CTCAAGGGCTCCGAGTAGACGGG - Intergenic
1039391849 8:37187547-37187569 CTGAAGGGCTTTGAGTGGAAGGG - Intergenic
1040823332 8:51589990-51590012 CTCAGGGCCTGCGATGGGAAGGG - Intronic
1040943290 8:52854252-52854274 ATCAGGAGCTGGAAGTGGAAAGG - Intergenic
1044174625 8:89103797-89103819 CTCAGGAGCAGAGAGTGAAATGG + Intergenic
1045900521 8:107273829-107273851 CCCAGGGACTGTGAGTGTAAAGG + Intronic
1047373485 8:124275262-124275284 CTTGGGGGCTGCAGGTGGAATGG - Intergenic
1048085601 8:131175127-131175149 CATGGGGGCTGGGAGTGGAAGGG - Intergenic
1049290343 8:141798345-141798367 CTTGGGGGATGCGAGAGGAACGG + Intergenic
1049376467 8:142291758-142291780 GTCAGGGCCTGCCAGTGAAAGGG + Intronic
1052990044 9:34513790-34513812 CTCCTGGGCTGCCAGTGGGAGGG - Intronic
1053098126 9:35346882-35346904 TTCAGGGGTTGGGAATGGAAAGG - Intronic
1057299808 9:93871292-93871314 CTCAGGGGCTGATAGGGGAGTGG - Intergenic
1059033214 9:110723464-110723486 CTCAGGGGAAAAGAGTGGAAGGG + Intronic
1059033326 9:110725248-110725270 CTCAGGGGAAAAGAGTGGAAGGG + Intronic
1060414655 9:123421813-123421835 CTCCTGGGCTGCCAGTGGCAGGG - Intronic
1060995567 9:127873482-127873504 CCCAGGGCCTGAGAGGGGAAGGG - Intronic
1061611814 9:131751775-131751797 CACAGGGGGTGTGAGTGGGAGGG - Intergenic
1061801723 9:133116533-133116555 GTCAGGGGCTGGGCGTGGACAGG - Intronic
1061949168 9:133926602-133926624 CTCAGGGGCAGCATGTGCAAAGG - Intronic
1062015530 9:134289368-134289390 CACAGGGGATCCGTGTGGAAAGG + Intergenic
1062094218 9:134694746-134694768 CACAGGGGCTGCCAGTGAAGCGG + Intronic
1062381746 9:136290195-136290217 TTCAGGGGCTGTGAGAGGCAAGG + Intronic
1062577653 9:137216027-137216049 CTCAGGGGCTGGGAAAGGAGGGG + Intronic
1188529739 X:31126480-31126502 CTCATGAGCTGCAAGTGGAGAGG + Intronic
1189186129 X:39056961-39056983 CTCTGAGGCTCCGAGAGGAAGGG + Intergenic
1192180892 X:68914852-68914874 CTGAGGAGCTGCGAGTGGGGGGG + Intergenic
1192988819 X:76428562-76428584 CTCAGTGGCGGCGAGCGGCACGG - Exonic
1193225022 X:78972150-78972172 CTCAGGGCCTGTGATGGGAAGGG + Intergenic
1194467021 X:94245995-94246017 CTCAGGGCCTGCGATGGAAAAGG - Intergenic
1194496388 X:94621581-94621603 CTCTGGGCCTGTGAATGGAAGGG + Intergenic
1196169480 X:112571956-112571978 CTCAGGTGCTGCAAGTGCAGCGG - Intergenic
1196941188 X:120777555-120777577 CTCATGGGCTGCAAGGGGACAGG + Intergenic
1197698996 X:129582876-129582898 CACAGGAGCTGGGAGTGGAGAGG - Intronic
1198568959 X:137935027-137935049 CTCAGGGCCTGCGATAGGAGGGG - Intergenic
1199085498 X:143624490-143624512 CAAAGGGGCTGCCAGTGGGAAGG + Exonic
1199298089 X:146181962-146181984 CTCAGGGGCAGCGGGTTGTAGGG - Intergenic
1199869892 X:151888837-151888859 GGGAGGGGCTGTGAGTGGAATGG + Intergenic
1200239314 X:154485673-154485695 TTCAGGGGCTGCCAGTGGTGGGG + Intronic