ID: 1184100319

View in Genome Browser
Species Human (GRCh38)
Location 22:42338512-42338534
Sequence GGGGCTGCGAGTGGAAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100314_1184100319 -6 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data
1184100310_1184100319 -1 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data
1184100302_1184100319 30 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data
1184100315_1184100319 -7 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data
1184100309_1184100319 7 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data
1184100307_1184100319 21 Left 1184100307 22:42338468-42338490 CCGGCCTGCAGGGGCCACTCGGC No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data
1184100305_1184100319 22 Left 1184100305 22:42338467-42338489 CCCGGCCTGCAGGGGCCACTCGG No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data
1184100308_1184100319 17 Left 1184100308 22:42338472-42338494 CCTGCAGGGGCCACTCGGCCAAT No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data
1184100304_1184100319 29 Left 1184100304 22:42338460-42338482 CCGGCAGCCCGGCCTGCAGGGGC No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100319 Original CRISPR GGGGCTGCGAGTGGAAGGGC TGG Intronic