ID: 1184100319

View in Genome Browser
Species Human (GRCh38)
Location 22:42338512-42338534
Sequence GGGGCTGCGAGTGGAAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 681
Summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 617}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100308_1184100319 17 Left 1184100308 22:42338472-42338494 CCTGCAGGGGCCACTCGGCCAAT 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG 0: 1
1: 0
2: 5
3: 58
4: 617
1184100305_1184100319 22 Left 1184100305 22:42338467-42338489 CCCGGCCTGCAGGGGCCACTCGG 0: 1
1: 0
2: 2
3: 44
4: 302
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG 0: 1
1: 0
2: 5
3: 58
4: 617
1184100309_1184100319 7 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG 0: 1
1: 0
2: 5
3: 58
4: 617
1184100302_1184100319 30 Left 1184100302 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG 0: 1
1: 0
2: 4
3: 43
4: 438
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG 0: 1
1: 0
2: 5
3: 58
4: 617
1184100314_1184100319 -6 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG 0: 1
1: 0
2: 5
3: 58
4: 617
1184100304_1184100319 29 Left 1184100304 22:42338460-42338482 CCGGCAGCCCGGCCTGCAGGGGC No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG 0: 1
1: 0
2: 5
3: 58
4: 617
1184100307_1184100319 21 Left 1184100307 22:42338468-42338490 CCGGCCTGCAGGGGCCACTCGGC 0: 1
1: 0
2: 3
3: 27
4: 248
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG 0: 1
1: 0
2: 5
3: 58
4: 617
1184100310_1184100319 -1 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG 0: 1
1: 0
2: 5
3: 58
4: 617
1184100315_1184100319 -7 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG 0: 1
1: 0
2: 5
3: 58
4: 617

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100319 Original CRISPR GGGGCTGCGAGTGGAAGGGC TGG Intronic
900118940 1:1040481-1040503 GGGTCTGCGAGGGGCAGGGCCGG + Intronic
900127482 1:1075047-1075069 GGGGCTGAGGCTGGCAGGGCTGG + Intergenic
900345462 1:2208352-2208374 GGGGCAGAGAGAGGAAGGGAGGG - Intronic
900601833 1:3506051-3506073 GTGGCAGCGGGTGGAAGGGATGG - Intronic
900658757 1:3772703-3772725 GGGGCCACGCGGGGAAGGGCTGG - Intergenic
900680605 1:3914330-3914352 GGGGCTGGCAGTGCTAGGGCAGG + Intergenic
900886736 1:5420710-5420732 GGGGCTGCAGGTGGAAGGTCAGG + Intergenic
900901350 1:5518627-5518649 GGGGCTGTGGGGGGAGGGGCCGG - Intergenic
901081854 1:6588208-6588230 GGGGAGGCGAGGGGAGGGGCAGG - Intronic
901148851 1:7086973-7086995 GGGGCTGCAAGTGCAGGGGAAGG + Intronic
901721279 1:11200012-11200034 TGGGGGGCGAGTGGCAGGGCGGG + Intronic
902088592 1:13883858-13883880 GGGGCTGCTAGTGTAAGTCCTGG + Intergenic
902162106 1:14538953-14538975 GGGGAGGCGAGTGGATGGGGAGG + Intergenic
902289387 1:15426653-15426675 GGGAGTGCGAGTGGCTGGGCGGG + Intronic
902920731 1:19664963-19664985 GGGGCTGCGAGAGGAAGAGGCGG - Intergenic
902931793 1:19736600-19736622 GGGGCTGCCTGTGGAGGGGCTGG - Intronic
903072275 1:20732262-20732284 GGCGCTCCGCCTGGAAGGGCGGG + Exonic
903156203 1:21445501-21445523 GGGGGTGAGAGGGGAAGAGCGGG - Intronic
903879841 1:26501005-26501027 GGGGCGGGGCCTGGAAGGGCGGG + Intergenic
904284458 1:29445041-29445063 GGGGAGGGGAGGGGAAGGGCAGG - Intergenic
904343227 1:29851567-29851589 GGGGCTGGGGGTGGCAGGGGAGG + Intergenic
904368870 1:30035891-30035913 GGGGAGGGGAGGGGAAGGGCAGG - Intergenic
904499382 1:30905393-30905415 GGGGTGGGGAGTGGAAGGGTGGG - Intronic
905274110 1:36806073-36806095 GGGGCTGCCTGTGGGAGGGGTGG - Intronic
905326676 1:37157691-37157713 GGGCCTGAAAGTGGAAGAGCTGG + Intergenic
905352793 1:37359134-37359156 GGGGCTGGGGGTGGCAGGGGAGG + Intergenic
905790634 1:40787461-40787483 GGGGCTCAGAGGGGACGGGCTGG - Intronic
905885085 1:41487386-41487408 GAGGCTGCAGGGGGAAGGGCAGG + Intergenic
906240778 1:44240929-44240951 GTAGCTGCAGGTGGAAGGGCAGG + Intronic
906290990 1:44619067-44619089 GGGGCTGGAGGTTGAAGGGCGGG + Intronic
906614403 1:47224890-47224912 GGGGCTGGGAGTGGAGGGACAGG + Intronic
906684086 1:47751786-47751808 GGGGCTGAGCGTTGAAGGCCAGG + Intergenic
907044785 1:51294188-51294210 GGGGCTGAGAGTGGAGAGACAGG - Intronic
907095926 1:51780793-51780815 GGGGCTTCAAGGGGAAGGGTGGG + Intronic
907284355 1:53370561-53370583 GGGGCTGGCAGTGGGAGGGCTGG + Intergenic
907315635 1:53569379-53569401 GAGGCTGCGTGTGTGAGGGCAGG + Intronic
907403323 1:54238926-54238948 GGGGGTGGGAGAGGAAGGGGTGG - Intronic
907882178 1:58560875-58560897 GAGGCTGTGTGTGGAGGGGCAGG + Intergenic
908168445 1:61481778-61481800 GGGGCAGTGAGTAGAAGGTCGGG + Intergenic
908510569 1:64847296-64847318 GGGGTTGGGGGTGGAAGGGAGGG + Intronic
911078919 1:93909195-93909217 GGGGCTGCGGGCGGGCGGGCAGG + Exonic
911659836 1:100488981-100489003 AGGGCTGAGGGTGGAAGGCCAGG + Intronic
913121717 1:115748473-115748495 AGGGGTGGGAGTGGAATGGCAGG + Intronic
915063359 1:153204881-153204903 GAGACTGCGAGGGGCAGGGCAGG - Exonic
915340778 1:155175567-155175589 GGGGCTGCGGGTGGAAGGGGTGG - Exonic
915519132 1:156431054-156431076 GGGGGTGCCAGTGGAATGGGGGG + Intergenic
915552359 1:156642483-156642505 GGGGCTGCCACTGGCAGAGCTGG - Intronic
915558055 1:156670863-156670885 GGGGCAGGGGGTGGGAGGGCTGG - Exonic
915629690 1:157142630-157142652 TGGGCTGCCAGTGGGAAGGCAGG - Intergenic
915978722 1:160407368-160407390 GGGGATGAGGGTGGCAGGGCTGG - Intronic
916100527 1:161390030-161390052 GGCGCGGCGAGAGGAGGGGCGGG + Intergenic
916786912 1:168093015-168093037 GGGTCGGCCAGCGGAAGGGCAGG + Intronic
916802300 1:168226399-168226421 TGAGCTGCGAGTGGGAGGGTGGG + Intronic
916985854 1:170191170-170191192 GGAGCTTCCAGAGGAAGGGCAGG - Intergenic
918144943 1:181747322-181747344 GGGGCTGGGAGGTGAAGAGCGGG + Intronic
918215842 1:182391565-182391587 AGGGCTGGGACTGGAGGGGCAGG + Intronic
920573126 1:207032946-207032968 TGGGCTGAGACTGGAAGGACAGG + Intronic
920660500 1:207910804-207910826 GGGGGTGGGAGGGGAAGGGAAGG - Intronic
920679289 1:208060363-208060385 GGGGCTGACAGGGGAAGGGCTGG + Intronic
921906149 1:220497433-220497455 GGGTGTGGGAGGGGAAGGGCAGG - Intergenic
922619909 1:226983069-226983091 GGGGCTGCAAGGGGCAGAGCTGG + Intronic
922994951 1:229948677-229948699 GGGTCTGCGAGTGGCTTGGCTGG - Intergenic
923019969 1:230155575-230155597 GGGGCTGGGAGGGACAGGGCAGG + Intronic
923258524 1:232243697-232243719 GGGGCTGTGGGTGGAAGAGTGGG - Intergenic
924424034 1:243934043-243934065 GGGGATGGGAGGGGAAGGGGAGG - Intergenic
1063238904 10:4148083-4148105 GGGCCTGAGAGTGGAGGGGGTGG + Intergenic
1063461095 10:6215447-6215469 GGGGCTGCGGGTGTAAGGCTGGG + Intronic
1063866386 10:10369300-10369322 CGGGCTGCGTGTTGAAAGGCAGG - Intergenic
1064629201 10:17292388-17292410 GGGGCTGGGAGTAGAAGGAGAGG - Intergenic
1065093087 10:22253387-22253409 GGGGCTGCGAGCGGAGGACCGGG - Intergenic
1065818648 10:29505756-29505778 GTGGCTGTGTGTGGGAGGGCAGG + Intronic
1065954272 10:30678640-30678662 GTGGCTGTGTGTGGGAGGGCAGG - Intergenic
1066749202 10:38635630-38635652 GGAGCTGCGAGTGGGCGGGTGGG - Intergenic
1066967456 10:42282162-42282184 GGAGCTGCGAGTGGGCGGGTGGG + Intergenic
1069001025 10:63265248-63265270 GGGGGTGGGAGTGCAAGGGGTGG - Intronic
1069605533 10:69736748-69736770 GGGCCTGGGAGAGGGAGGGCTGG - Intergenic
1069619925 10:69830901-69830923 GGGGCTGGGGGTCGGAGGGCGGG - Intronic
1069891772 10:71656594-71656616 GGGGCGGGGAGTGCCAGGGCTGG + Intronic
1069915188 10:71782859-71782881 GAGCCTGGGAGCGGAAGGGCTGG + Intronic
1070806692 10:79274949-79274971 AGGGCTGCGAGGGGTGGGGCGGG + Intronic
1071508340 10:86246234-86246256 GGGTCAGGGAGTGGCAGGGCCGG - Intronic
1071531405 10:86392477-86392499 GGGGCTGCAAGCGGCAGGGTGGG + Intergenic
1071618219 10:87095095-87095117 GGGGAGGGGAGAGGAAGGGCGGG + Intronic
1071618239 10:87095145-87095167 GGGGCAGGGAGGGGAAGGTCGGG + Intronic
1071784216 10:88880729-88880751 GACGCTGCCAGCGGAAGGGCCGG - Intronic
1072587429 10:96795219-96795241 CGGGCTGTGACTGGGAGGGCTGG + Intergenic
1073037088 10:100571620-100571642 GGGGCTGGGGGTGGATGGGTCGG - Intergenic
1073248571 10:102108036-102108058 GGGGCTGTGAGGGGTGGGGCAGG + Exonic
1074755404 10:116620947-116620969 TGGGCTGTGAGTGGAAGCTCTGG + Intronic
1075554360 10:123419619-123419641 GGGGCTGCGTGTGGGGGGACGGG - Intergenic
1076053252 10:127351882-127351904 GGAGCTGTGAGGGGAAGGGCCGG - Intronic
1076322825 10:129596092-129596114 GGGGCAGGGAGGGGCAGGGCGGG - Intronic
1076402551 10:130193524-130193546 GTGGCTGTGGGTGAAAGGGCAGG - Intergenic
1076689059 10:132211635-132211657 GGGGCTGTCAGAGGAAGAGCAGG - Intronic
1076764811 10:132627275-132627297 GGGGCTGAGGGTGGACAGGCTGG + Intronic
1076781240 10:132725805-132725827 GGGGCTGCCAGGGCAGGGGCAGG - Intronic
1076888581 10:133273539-133273561 GGGGCTGCTGGTGGCAGGGTAGG - Intronic
1076903664 10:133351892-133351914 GGGGCTGCTGGTGGTGGGGCTGG + Intronic
1077015563 11:397671-397693 GGGGCAGCGAGTGGGTGGTCGGG - Intronic
1077034618 11:488658-488680 GGGGCTGCGAGGGCAGGGCCGGG + Intronic
1077051306 11:568268-568290 GGGGCTGCGGGGGGTCGGGCTGG - Intergenic
1077052935 11:575911-575933 GGGGCTGCGAGGGTGGGGGCGGG + Intergenic
1077052951 11:575958-575980 GGGGCTGCGAGGGAGGGGGCGGG + Intergenic
1077082949 11:733425-733447 GGGGCTGCCCGGGGAAGAGCTGG + Intergenic
1077174002 11:1180590-1180612 GGGGCTGGGAGCGGCAGGGCTGG + Intronic
1077240600 11:1508531-1508553 AGGGCTGTGAGGGGGAGGGCAGG - Intergenic
1077327801 11:1971244-1971266 GGGGCGCTGGGTGGAAGGGCTGG - Intronic
1077339449 11:2019534-2019556 GGAGCTGTGAGAGGAAGGGAAGG - Intergenic
1077357128 11:2123554-2123576 GGGACTGGGAGTGGAGGGGTGGG + Intergenic
1077413378 11:2413706-2413728 GGGGCTCCGGGAGGGAGGGCTGG - Intronic
1077478630 11:2802787-2802809 GGGACTGTGAGGTGAAGGGCTGG - Intronic
1077536678 11:3127969-3127991 GGGGTGGGGAGGGGAAGGGCTGG - Intronic
1077555759 11:3225357-3225379 GGGGTTGCGGGTGGATGGGGTGG + Intergenic
1078098680 11:8315942-8315964 GGGGCAGCGGGTGGGAGGGAGGG - Intergenic
1078467536 11:11561276-11561298 GGCGTTGCGAGTGGAAGGTAGGG - Intronic
1079827487 11:25214911-25214933 GGGGATGGGAGGGGAAGGGATGG - Intergenic
1083224621 11:61276951-61276973 GGGGAGGGGAGGGGAAGGGCAGG + Intronic
1083297320 11:61722017-61722039 GGGGCTGAGACTGGAGGGGAGGG - Intronic
1083595890 11:63918120-63918142 GGGGCTCCGGGTGGGAGGGGCGG - Intergenic
1083782229 11:64924618-64924640 GGGGCTGCGTCAGGAAGGCCCGG - Intronic
1083847697 11:65345544-65345566 GGAGCTGCTAGGGGAAGGGATGG + Intronic
1084189349 11:67491957-67491979 GGGGCTGCGTGTGGGAGGCTGGG - Exonic
1084351855 11:68607348-68607370 GGGGAAGGGAGAGGAAGGGCTGG + Intronic
1084504035 11:69554030-69554052 GGGACTGCAAGTGGAGGAGCGGG + Intergenic
1085259316 11:75195348-75195370 GGGGGTGGGAGTGGGAAGGCTGG - Intronic
1085312693 11:75525675-75525697 GGGGCTGGGACGGGCAGGGCAGG + Exonic
1085404207 11:76252266-76252288 GGGGCTGAGAGGAGAGGGGCCGG - Intergenic
1085725893 11:78954208-78954230 GGGGCTGCCTGGGGAAGGGTGGG + Intronic
1086001740 11:81992368-81992390 AGTGCTGGGAATGGAAGGGCGGG + Intergenic
1086628200 11:88985099-88985121 GGGTGTGAGAGTGGAATGGCAGG - Intronic
1087318833 11:96635849-96635871 GGGGCTGCGGGTGCAAGTTCCGG + Intergenic
1087840726 11:102918284-102918306 GGGGCTGGGAGTGGGAGAGAGGG - Intergenic
1088826136 11:113496080-113496102 GGGGCATGGAATGGAAGGGCAGG - Intergenic
1089378309 11:118010787-118010809 GGGGCTGGGGGTCCAAGGGCTGG - Intergenic
1089556232 11:119317196-119317218 GGGGCTGCGCGGGGCGGGGCGGG - Intronic
1089580172 11:119476749-119476771 GTGGCTGGGAGTGGATGAGCTGG + Intergenic
1089640431 11:119844241-119844263 GGGGCAGGGGGTGGAGGGGCAGG - Intergenic
1089655607 11:119944593-119944615 GGGGCTGAGAGGGGAGGGGAGGG + Intergenic
1090425992 11:126607374-126607396 TTGGCTGGGAGAGGAAGGGCTGG + Intronic
1090662419 11:128891517-128891539 GGGGCCGCGAGTGAAGGGACAGG + Exonic
1091101728 11:132880926-132880948 GGGGCTGGGAATGGAAGTGGGGG - Intronic
1202810781 11_KI270721v1_random:26424-26446 GGGGCGCTGGGTGGAAGGGCTGG - Intergenic
1202822434 11_KI270721v1_random:74723-74745 GGAGCTGTGAGAGGAAGGGAAGG - Intergenic
1091397178 12:161103-161125 GGAGCTGCGTGTGGAAGGCGGGG + Intronic
1091714578 12:2767838-2767860 GGGGCTGACTGTGGAAGGGATGG - Intergenic
1091738041 12:2939502-2939524 GGGGCAGGGAGGGGAAGGGGAGG - Intronic
1091840512 12:3617124-3617146 GGGGCTGCGAGAGGAAGTGAAGG - Intronic
1093168449 12:15832509-15832531 GGGGCAGGGAGTGGAAAGGAGGG - Intronic
1095953494 12:47794213-47794235 GGGGCTGTGAGTGTGAGGGCAGG - Intronic
1096072368 12:48782482-48782504 GGGGCTTAGTGAGGAAGGGCGGG - Intronic
1096156291 12:49343071-49343093 CGGGCTGCGAGTGGACGTGCCGG + Intergenic
1096658220 12:53104926-53104948 AGGCCTGCGGGGGGAAGGGCAGG - Intronic
1096849537 12:54426872-54426894 CGGGGTGGGAGTGGGAGGGCAGG - Intergenic
1102447574 12:113015334-113015356 GGGGCTCCAATTGGCAGGGCAGG + Intergenic
1102616321 12:114157818-114157840 GGGGGTGAGGGTGGAAGGGAGGG - Intergenic
1104350870 12:128042814-128042836 GGCCTTGGGAGTGGAAGGGCGGG - Intergenic
1104894983 12:132159599-132159621 GGGGCTGGGCGTGGAAGGGCGGG + Intergenic
1105601936 13:21895289-21895311 GGGGGTGCGGGGGGAGGGGCGGG + Intergenic
1105620911 13:22065165-22065187 GAGGGTGGGAGTGGAAGGCCTGG + Intergenic
1105725588 13:23159884-23159906 GGGGCTCGGAGTGGGAGTGCAGG + Intergenic
1105950125 13:25222901-25222923 GGAGCTGCGATTTCAAGGGCGGG + Intergenic
1106495613 13:30271505-30271527 GGGGGTGCGGGCGGAAGGTCAGG + Intronic
1106598393 13:31166522-31166544 GGGGGTGCGGGAGGAAGAGCAGG - Intergenic
1107086552 13:36432382-36432404 GGGGCAGGGCGGGGAAGGGCAGG - Exonic
1107624871 13:42272108-42272130 GGGGCTGGGAGGGGGAGGGCTGG + Intergenic
1108078154 13:46703098-46703120 GGGGCAGTTAGTGAAAGGGCAGG + Intronic
1110356789 13:74575982-74576004 GGGACAGCGAGGGGGAGGGCCGG + Intergenic
1110646694 13:77893939-77893961 GGGGTTGTGAGAGGCAGGGCTGG - Intergenic
1110670865 13:78175922-78175944 GTGGCAGAAAGTGGAAGGGCAGG + Intergenic
1112426235 13:99304003-99304025 GTGGCTGCGGGCAGAAGGGCGGG - Intronic
1113391616 13:109903323-109903345 GGGAGTGCGGGAGGAAGGGCTGG + Intergenic
1113582505 13:111439058-111439080 AGGGCTGCGAGTGGAAGAGCTGG - Intergenic
1113946127 13:114044537-114044559 AGGGCTGCCGGTGGGAGGGCGGG - Intronic
1114351879 14:21861576-21861598 GGGGCTGACAGGGGAAGGGAGGG + Intergenic
1117602594 14:57390720-57390742 GGGGCCGCGAGTGACAGGGCTGG + Intronic
1117866863 14:60159004-60159026 GGTGCTGGGAGAGGAAGGGATGG - Intronic
1118764367 14:68900013-68900035 GGGGCTGAGAGGGGCTGGGCAGG + Intronic
1118919207 14:70134405-70134427 GGGACTGCGAGTGGTATGGACGG - Intronic
1119070103 14:71574166-71574188 AGGGGTGGGAGTGGAAGGGGTGG + Intronic
1119644328 14:76337559-76337581 GGGGCTGGATGGGGAAGGGCGGG + Intronic
1120079105 14:80195463-80195485 GGGGCTGGGAGTGGCAAGGGAGG + Intergenic
1120727388 14:87960134-87960156 GGGGCTGGGAAGGGAAGGACAGG + Intronic
1120727408 14:87960256-87960278 GGGGCTGGGAAGGGAAGGACAGG + Intronic
1120933845 14:89874335-89874357 GGGCCTGCGATGGGAGGGGCTGG + Intronic
1121112411 14:91321344-91321366 GGGGCAGAGAGTGGAAGTGGAGG - Intronic
1121112441 14:91321452-91321474 GGCACTGGGAGTGGAGGGGCAGG - Intronic
1121242768 14:92441882-92441904 GGGGCTCTGAGTGGAATGCCTGG + Intronic
1121335766 14:93076771-93076793 GTGGCTGGGAGTGGAAGGCATGG - Intronic
1121646020 14:95517216-95517238 GGGGGTGGGAGAGGACGGGCAGG - Exonic
1121713836 14:96058796-96058818 AGGGCTGCCACTGGCAGGGCTGG + Intronic
1121873588 14:97431061-97431083 GGGACTGCAAGAGGAAGGACAGG + Intergenic
1122127586 14:99587548-99587570 GGGGCTGTGAGGGACAGGGCTGG - Intronic
1122272198 14:100573300-100573322 GGGGCCGCCAGAGGAGGGGCGGG + Intronic
1122961916 14:105097844-105097866 GGGGCTGCCACAGGAAGGCCAGG + Intergenic
1125888622 15:43249056-43249078 GGGGCTGTAAGGGGAAGGGGAGG - Intronic
1128096608 15:64961031-64961053 GGGGCTAGAAGAGGAAGGGCAGG + Intergenic
1128684164 15:69671438-69671460 GGGGCTGAGGGAGCAAGGGCGGG - Intergenic
1129063543 15:72881121-72881143 GGGGCTGCTAGTGCAAGTCCTGG + Intergenic
1129162150 15:73752950-73752972 GGCGCGGCGAGGGGAAGGGAGGG + Intergenic
1129245468 15:74276453-74276475 GGGGCTGAGAGAGGAGGGGATGG - Intronic
1129698087 15:77752045-77752067 AGGCCTGCAAGTGGCAGGGCTGG + Intronic
1129702189 15:77774411-77774433 GGGGCTGGGAGTGGAATTGGTGG - Intronic
1130863332 15:87910079-87910101 GGGGCTTCTTGTGGAAGGTCAGG + Intronic
1131091792 15:89629261-89629283 GGGGCTGTGAGTGGCAGGGGCGG + Intronic
1131177577 15:90219704-90219726 GGGCCTGGGTGTGGAAGGGGGGG + Intronic
1132382080 15:101373038-101373060 GGGGCTCAGAGTGGCGGGGCAGG - Intronic
1132554122 16:565173-565195 GGGGCTGCGAGGGGGAGCCCTGG - Exonic
1132670288 16:1099725-1099747 GGGGCTGCAGGAGAAAGGGCAGG + Intergenic
1132725061 16:1334815-1334837 GGGGCTGAGGGAGGAAGAGCAGG + Intronic
1132743826 16:1428645-1428667 GGGCCTGCGGAGGGAAGGGCGGG - Intergenic
1132774017 16:1581803-1581825 GGGGATGGGAGTGGAGGGGAGGG + Intronic
1132819721 16:1858421-1858443 GGGGCACAGAGTGCAAGGGCCGG - Intronic
1132950958 16:2562279-2562301 GGGCCTGCCAGTGGCTGGGCTGG + Intronic
1132963391 16:2637891-2637913 GGGCCTGCCAGTGGCTGGGCTGG - Intergenic
1133239745 16:4407462-4407484 GGGGCTGCCCTGGGAAGGGCAGG + Intronic
1134101136 16:11452408-11452430 GGGGCTGCTGGAGGAAAGGCAGG + Intronic
1136247039 16:28982081-28982103 GGGCCTGCGGGTGGCAGGGCTGG + Intronic
1136778739 16:32884767-32884789 AGGGCTGCGAGGGGAGGGGAGGG + Intergenic
1136891879 16:33976747-33976769 AGGGCTGCGAGGGGAGGGGAGGG - Intergenic
1137368997 16:47887334-47887356 GGGGCTGCGGGTGGGAGGCAGGG - Intergenic
1137408297 16:48207224-48207246 GGGGCTCCCTGGGGAAGGGCTGG + Intronic
1138238631 16:55407691-55407713 GGGGCAGAGAGTGGATGGGTTGG + Intronic
1138350824 16:56345407-56345429 GGGGCTGCAAGTGGAAACCCAGG - Exonic
1138607319 16:58097423-58097445 CGGCCAGCTAGTGGAAGGGCTGG + Intergenic
1138630892 16:58293435-58293457 GGGGCTGGGAGTGAAGAGGCAGG + Intronic
1138671506 16:58618977-58618999 GAGGCTGGGAGTGCAAGGCCAGG + Intronic
1138738492 16:59280133-59280155 GGCTCTGCTACTGGAAGGGCAGG - Intergenic
1139432526 16:66918777-66918799 GGGGCTGGGAGTGGAGGGGAGGG - Intronic
1139461908 16:67129190-67129212 GGGGCTGTGGAAGGAAGGGCAGG - Intronic
1139759328 16:69171695-69171717 GGGGATGTGAGGGGAAGGGAAGG + Intronic
1140882429 16:79211083-79211105 GGTGCTGCTAGGGGAAGGGTTGG - Intronic
1141217226 16:82035871-82035893 GGGGCTGGTAGTGGGAGGGAAGG + Intronic
1141831294 16:86511190-86511212 GGGGCACCGAGTGGCTGGGCAGG - Exonic
1142052077 16:87965390-87965412 GGGGCTGGGGCTGGAGGGGCAGG + Intronic
1142065556 16:88060342-88060364 GGGGCTGAGATTGGAAAGGCTGG + Intronic
1142211408 16:88810389-88810411 GGGGTGGCCAGAGGAAGGGCAGG - Intronic
1142598235 17:1039922-1039944 GGGGCTGTGAGTGCCAGGGCAGG + Intronic
1142976567 17:3648226-3648248 GGAGCTGGGAGCGGAATGGCAGG - Intronic
1143369253 17:6428293-6428315 GGGGCTGGGGTTGGCAGGGCTGG - Intronic
1143452015 17:7042197-7042219 GGGGCTGTGGGTGGTGGGGCTGG - Exonic
1143598477 17:7929459-7929481 GGGGCTCCGAGGGGACGGGAGGG + Intronic
1143852917 17:9826088-9826110 GGGCCTGGGAGAGGAAGCGCGGG + Exonic
1144027205 17:11287729-11287751 GGGGCTGGGAAGGGAAGGGAAGG + Intronic
1144625181 17:16840805-16840827 GGGGCTGAGGGTGGAGAGGCCGG + Intergenic
1144713793 17:17420592-17420614 GGAGCAGAGAGTGGAGGGGCAGG + Intergenic
1144750861 17:17647161-17647183 GGGGCTGCAGGGGGAAGGGATGG + Intergenic
1144881250 17:18431916-18431938 GGGGCTGAGGGTGGAGAGGCCGG - Intergenic
1145078931 17:19878511-19878533 GGAGCTGCGAGGGGGAGGGGTGG + Intergenic
1145150982 17:20512470-20512492 GGGGCTGAGGGTGGAGAGGCCGG + Intergenic
1145283242 17:21483721-21483743 GGGGCTGGGAGTGGAGGGGATGG + Intergenic
1145394241 17:22482079-22482101 GGGGCTGGGAGTGGAGGGGATGG - Intergenic
1145826557 17:27881279-27881301 GGGGCTGGGAGTGACAGGGGAGG - Intronic
1146000856 17:29129463-29129485 GGGACTGCCACTGGAAGGCCAGG + Intronic
1146185217 17:30720146-30720168 AGGGCTGTGTGTGGAGGGGCCGG + Intergenic
1146255908 17:31391587-31391609 GGGGCGGGGAGGGGAGGGGCGGG - Intergenic
1147142141 17:38466002-38466024 GTGGGTGGGGGTGGAAGGGCAGG - Intronic
1147258999 17:39197739-39197761 GGGGCTGCGAGGGGCGGGGCCGG - Intergenic
1147331725 17:39703249-39703271 GGGGCTGCGGCTGGGAGGGCTGG + Intronic
1147428113 17:40355949-40355971 GGGGCTGGGGGTGGGAGGGCTGG + Intronic
1147782837 17:42956121-42956143 GGGGCTGGGAGTGGGAGAGGGGG - Intronic
1147862814 17:43533463-43533485 GGGGCTGAGAAGGGAACGGCAGG + Intronic
1148079159 17:44957971-44957993 TGGGGTGGAAGTGGAAGGGCTGG + Intergenic
1148092823 17:45032860-45032882 GGGCCTCCGAGTTGAAGGCCTGG - Intronic
1148240472 17:45996697-45996719 GGGGCTGCGCCTGGAGGGGTAGG + Intronic
1148690633 17:49524971-49524993 GGGGCTGGGAGTGGAGGGGAGGG - Intergenic
1148865112 17:50624257-50624279 GGGGGAGAGAGTGGAAGGGAGGG + Intronic
1149038281 17:52158537-52158559 AGGGCGCCGAGGGGAAGGGCTGG + Exonic
1149315145 17:55431884-55431906 GGGGAGGGGAGGGGAAGGGCAGG + Intergenic
1149531814 17:57401779-57401801 GGGGCTGTGACTCGCAGGGCAGG + Intronic
1149646968 17:58248142-58248164 GGGGGTGAGAGTGGAGGGGATGG - Intronic
1150236983 17:63601179-63601201 GGGGCTCGGGGTGGGAGGGCCGG - Exonic
1151292948 17:73163686-73163708 GTGTATGCAAGTGGAAGGGCTGG - Intergenic
1151428458 17:74046782-74046804 GGGGCTGGGAGTGGGAGGAGAGG - Intergenic
1151482677 17:74379620-74379642 GGGCCAGGGAGTGGGAGGGCGGG + Intergenic
1151572694 17:74935217-74935239 AGGGCTGGGAGAGGGAGGGCTGG + Intergenic
1151903978 17:77035785-77035807 GGGGATGGGAGTGGAAAGGTAGG + Intergenic
1152279899 17:79379105-79379127 GGGGCTGGGAGTGGCAGAGGTGG - Intronic
1152354040 17:79798107-79798129 GGGGCGGCGAGGGGAAGGCGAGG - Intronic
1152388943 17:79991714-79991736 GGGGCGGGGAGGGGGAGGGCGGG + Intronic
1152656655 17:81523057-81523079 GGGGCTGTGCCTGGAAGGGGAGG - Intronic
1152658017 17:81528933-81528955 GGGCCTGCGGGTGGATGGCCAGG - Exonic
1152676787 17:81645321-81645343 GGGGCTGGCACTGGGAGGGCTGG + Exonic
1152710206 17:81867588-81867610 GGTGGTGGGAGGGGAAGGGCAGG - Intergenic
1152714459 17:81891812-81891834 GGCGCTGCCAACGGAAGGGCGGG + Exonic
1152741374 17:82019940-82019962 GGGGGTGCGGGGGGGAGGGCGGG - Intronic
1152799761 17:82325368-82325390 TCGGCTGCGTGAGGAAGGGCAGG + Intronic
1152800569 17:82328873-82328895 GGAGCTGGGAGAGGCAGGGCTGG - Intronic
1203178317 17_KI270729v1_random:36325-36347 GTGGCCGCGAATGGAAGGGGTGG + Intergenic
1155061553 18:22233344-22233366 GAGGCAGAGAGTGGAAAGGCAGG - Intergenic
1155791169 18:29972110-29972132 GTTGCTGGGAGGGGAAGGGCAGG - Intergenic
1156526843 18:37775738-37775760 GGGGCTGCGAGAGAAAAGGAGGG + Intergenic
1157149786 18:45205165-45205187 GGTGCTGCTAGGGGAAGGTCTGG - Intergenic
1157402406 18:47399597-47399619 GGAGTGGCCAGTGGAAGGGCAGG + Intergenic
1158190972 18:54828466-54828488 AGGACTGCGAGTGGCAGGGCTGG - Exonic
1159097592 18:63921914-63921936 GGGGTTGGGGGTGGCAGGGCAGG - Intronic
1160163242 18:76491339-76491361 GGGGCTGCGGGGGGAAGGGCAGG - Intronic
1160527095 18:79544463-79544485 AGGGCTGCCAGGGGAAGGGCTGG - Intergenic
1160883129 19:1331580-1331602 GGGGCTGCCTGGGGAGGGGCTGG + Intergenic
1160957166 19:1699128-1699150 GAGGCTCCGAGTGGAGGGCCGGG + Intergenic
1161026154 19:2038342-2038364 GGGGCTGCGCCGGGAAGGGCGGG + Exonic
1161256275 19:3311588-3311610 GGAGGGGCGAGGGGAAGGGCTGG - Intergenic
1161498051 19:4598139-4598161 GGGGCTGAGAGGAGAGGGGCGGG + Intergenic
1162034442 19:7931640-7931662 GGGGCAGCGAGAGGGAGGGGTGG + Intronic
1162126592 19:8502672-8502694 GGGGCTGCTAGAGGTGGGGCGGG + Exonic
1162973563 19:14195543-14195565 AGGGCTGTGTGTGGAGGGGCCGG - Intronic
1162991095 19:14302642-14302664 GGGGATGGGAGTGGAGGGGAGGG + Intergenic
1163462655 19:17448315-17448337 GGGGCTGCGCGCCGAGGGGCTGG - Exonic
1163722157 19:18903465-18903487 GGGGCTGGCGGGGGAAGGGCCGG - Intronic
1164678279 19:30117599-30117621 GCTGCTGCGAGTGGAGGGCCGGG + Intergenic
1164767287 19:30781757-30781779 GGGGCTGGGTGTGGACGGGAAGG - Intergenic
1164844713 19:31422129-31422151 GGGGCTGAAATTGGCAGGGCCGG - Intergenic
1164981688 19:32619235-32619257 GAGGCTTCCAGAGGAAGGGCTGG - Intronic
1165040546 19:33064951-33064973 CGGGGTGGGAGTGGAGGGGCGGG - Intergenic
1165055587 19:33174361-33174383 GGGGCTGGGAGAGCCAGGGCAGG + Intronic
1165074028 19:33270746-33270768 GAGGCTGAGAGTGGCAGGTCTGG - Intergenic
1165421956 19:35726546-35726568 GGTGGTGGGAGTGGAAGGCCTGG + Intronic
1165717525 19:38056040-38056062 GGGGCTGAGAGTGGGAGTGATGG + Intronic
1165834039 19:38743733-38743755 GGGTCTGAGGGAGGAAGGGCTGG - Intronic
1166297123 19:41894836-41894858 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1166305478 19:41934867-41934889 GGGTCTGAGAGAGGAGGGGCTGG + Intergenic
1166306318 19:41938661-41938683 GGGTCTGGGAGAGGAAGGTCTGG - Intergenic
1166306515 19:41939216-41939238 GGGTCTGGGAGAGGAAGGTCTGG - Intergenic
1166330708 19:42076497-42076519 GGGGCTGAGTGAGGAGGGGCGGG + Intronic
1166347774 19:42177033-42177055 GGGGCTGCGAGGGGAGAGGGAGG + Intronic
1166521913 19:43486477-43486499 GGGTCTGAGGGTGGAGGGGCTGG + Intronic
1166523191 19:43495067-43495089 GGGTCTGAGAGAGGAGGGGCTGG + Intronic
1166525627 19:43507858-43507880 GGGTCTGAGAGAGGAGGGGCTGG - Intronic
1166525638 19:43507895-43507917 GGGTCTGAGAGAGGAGGGGCTGG - Intronic
1166644300 19:44519823-44519845 GGTGCAGCCTGTGGAAGGGCTGG - Intronic
1166662165 19:44654212-44654234 GGGACTGAGAGAGGAGGGGCTGG + Intronic
1166683361 19:44781435-44781457 GGGTCTGAGGGAGGAAGGGCCGG + Intronic
1166874900 19:45891134-45891156 GGGGGTGGCAGTGGAGGGGCTGG + Exonic
1167244275 19:48364395-48364417 GGGGTGGCGAAAGGAAGGGCGGG + Exonic
1167249364 19:48392249-48392271 GGGTCTGAGGGAGGAAGGGCTGG - Intergenic
1167265823 19:48482800-48482822 GGGTCTGAGGGAGGAAGGGCTGG - Intergenic
1167266112 19:48483543-48483565 GGGTCTGAGGGAGGAAGGGCTGG - Intergenic
1167276627 19:48543861-48543883 GGGTCTGAGGGAGGAAGGGCTGG - Intergenic
1167276636 19:48543890-48543912 GGGTCTGAGAGAGGAGGGGCTGG - Intergenic
1167276764 19:48544254-48544276 GGGTCTGAGAGAGGAGGGGCTGG - Intergenic
1167276846 19:48544476-48544498 GGGTCTGAGAGAGGAGGGGCTGG - Intergenic
1167297082 19:48657347-48657369 TGAGCTGTGATTGGAAGGGCCGG + Intergenic
1167298325 19:48664502-48664524 GGGGCTGAGGGAGGAGGGGCTGG - Intronic
1167327315 19:48834541-48834563 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1167327341 19:48834615-48834637 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1167327367 19:48834689-48834711 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1167327445 19:48834910-48834932 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1167333023 19:48867970-48867992 GGGGGTGCATGTGGGAGGGCGGG - Intronic
1167426967 19:49434402-49434424 GGGTCTGAGAGAGGAGGGGCTGG - Intronic
1167460105 19:49620621-49620643 GGGTCTGAGAGAGGAGGGGCTGG + Intronic
1167460151 19:49620753-49620775 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1167495984 19:49818859-49818881 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1167668967 19:50838915-50838937 GGGTCTGAGAGAGGAGGGGCTGG + Intergenic
1167738496 19:51311161-51311183 GGGTCTGAGAGAGGAGGGGCTGG + Intergenic
1167798602 19:51726568-51726590 GGGCCTGAGAGAGGAAGGGCTGG - Intergenic
1168155568 19:54471986-54472008 GGGTCTGAGGGAGGAAGGGCTGG - Intronic
1168266102 19:55224867-55224889 GGGTCTGGGAGAGGAGGGGCTGG - Intergenic
1168290295 19:55354236-55354258 GGGGCTGAGCCTGGAGGGGCGGG - Exonic
1168296366 19:55379005-55379027 GGGGCTTAGAGTGGAGGGTCTGG + Intergenic
1168327762 19:55546786-55546808 GGGTCTGAGGGAGGAAGGGCTGG - Intergenic
1168394808 19:56038755-56038777 GGGCCTCCGAGTGGAAACGCAGG + Intronic
925578469 2:5385049-5385071 GGGGCTGAGAGGGGACTGGCAGG - Intergenic
925609325 2:5691356-5691378 GGGGCGGGGAGAGGAGGGGCGGG + Intergenic
926250878 2:11155106-11155128 GGGGCTAGGAGGGGAGGGGCGGG + Intergenic
926497187 2:13605022-13605044 GGGGAAGCGAGGGGAAGGGACGG - Intergenic
927085781 2:19672902-19672924 AGGGCTGGGAGTGGAAGGGAGGG + Intergenic
927475433 2:23410953-23410975 GGGGCTGGGGGAGGAAGGGAAGG - Intronic
927638312 2:24831806-24831828 GGGGCTAGGAGAGGAAGGGACGG + Intronic
927855885 2:26527787-26527809 GGGGCTGGGCCTGGACGGGCTGG - Intronic
928149192 2:28810913-28810935 GGGGCTGCGCGGGAGAGGGCCGG - Exonic
928675245 2:33644642-33644664 GGGGATGGGAGTGGCAGGGGTGG - Intergenic
929991073 2:46787467-46787489 GGGGCTGCTGATGGAAGGCCTGG - Intergenic
930982771 2:57547750-57547772 GGGGAGGGGAGTGGAAGGGAGGG + Intergenic
931283578 2:60814476-60814498 TGGGGTGGGAGTGGAAGGGAGGG - Intergenic
931429639 2:62197724-62197746 GGGACTGGGAGTGAAAAGGCGGG + Intronic
932339766 2:70955480-70955502 GGGGCTGGGAGAGGGAGGACTGG - Intronic
932735634 2:74252254-74252276 GGGGCTGGCAGTGGCGGGGCCGG - Exonic
933775017 2:85766577-85766599 GGGGCTGGTATGGGAAGGGCTGG - Intronic
933981123 2:87551886-87551908 GGGGCTGTGAGGGGCAGAGCTGG - Intergenic
934045639 2:88170717-88170739 GGGGCTGGGAGTGGAATCTCAGG + Intronic
934523263 2:95033073-95033095 TGGGCTGGGAGGGGAGGGGCTGG + Intronic
935232842 2:101114323-101114345 GGGGGTGCAAGGGTAAGGGCTGG + Intronic
935594399 2:104867950-104867972 GGGGCGCCGAGTAGAGGGGCGGG - Intergenic
935637308 2:105259306-105259328 GGGCTTGGGAGGGGAAGGGCTGG - Intergenic
936312710 2:111398913-111398935 GGGGCTGTGAGGGGCAGAGCTGG + Intergenic
936988210 2:118332296-118332318 GTGGCTGGGAGCTGAAGGGCTGG - Intergenic
937122706 2:119451922-119451944 GGGGCAGAGGGTGGAAGGACAGG - Intronic
937355841 2:121197608-121197630 GGAACAGGGAGTGGAAGGGCAGG - Intergenic
938408738 2:131046735-131046757 GGGGCTGGGAGGCGAAGGGCGGG - Exonic
940014700 2:149091999-149092021 TGGGCTGCGGGTGGAAGGGTGGG + Intronic
940155501 2:150651911-150651933 GGGGTTGGGAGTGGAAGAGTAGG - Intergenic
940514336 2:154661687-154661709 GGGGCTGGAGGTAGAAGGGCTGG + Intergenic
942463820 2:176188450-176188472 GGGGCTGCCTGGGCAAGGGCGGG - Intergenic
943645974 2:190408343-190408365 GGGGCTGCGACGGGCTGGGCGGG - Exonic
944583859 2:201156707-201156729 GGGGTGGGGAGGGGAAGGGCAGG - Intronic
944676169 2:202035208-202035230 GGGGCAGCGCGGTGAAGGGCAGG - Exonic
944817964 2:203398709-203398731 GGAGCTGGGAGTGGAAGGGAAGG - Intronic
945043727 2:205763878-205763900 AGGGCGGCGAGTGGAAGCACGGG + Exonic
946248092 2:218398563-218398585 GGGGCCGGGAGGGGAAGGGAGGG - Intronic
946841611 2:223825494-223825516 GGGGCTGAGCCTGGAAGGGTGGG - Intronic
947588462 2:231371059-231371081 TGGGCTGCGACTGGCTGGGCTGG - Intronic
947932680 2:233976533-233976555 GGGGCTGCGGGAGGAAGGGTGGG + Intronic
948557367 2:238822481-238822503 GGTGCTGCGGATGGAAGGGAAGG + Intergenic
948725500 2:239931318-239931340 GGGGCTGTGTGAGGACGGGCAGG - Intronic
1168754926 20:309892-309914 GCGGCTGCAAGTGGCAGGGCTGG + Intergenic
1170567977 20:17617335-17617357 GGGCCTGCAATTTGAAGGGCAGG + Intronic
1172036558 20:32014981-32015003 GGGGCATCGAGTGCAGGGGCCGG - Exonic
1172068909 20:32241983-32242005 GAGCCTGTGAGTGGAAGAGCTGG + Intergenic
1172221925 20:33280122-33280144 GGGGCTGGGAGTGGCTGGGGTGG - Intronic
1172631644 20:36382385-36382407 GGGGGTGGGGGTGGAGGGGCAGG + Intronic
1173010296 20:39175998-39176020 TGGGCTGCCAGTGGAAATGCGGG + Intergenic
1173243339 20:41317274-41317296 GGGGCTCCGGGGGGAAGGGGCGG + Intronic
1173804027 20:45912237-45912259 GGGGCTGGGAGGGGACGGGGCGG + Intergenic
1173873569 20:46356442-46356464 GAGGCTGAGAGAGCAAGGGCTGG + Intronic
1173916066 20:46709589-46709611 GGCGCTGCGCGCGGGAGGGCAGG + Exonic
1174114220 20:48215785-48215807 TGGGCTGGGCCTGGAAGGGCAGG - Intergenic
1174321863 20:49748241-49748263 AGGGCTGCGAGTTGAAGGCCAGG + Intergenic
1174484443 20:50852279-50852301 GGGGCTGTGACTGGCAGGGGAGG + Intronic
1174504802 20:51010242-51010264 GGCGCTGCGGGAGGAAGGCCGGG + Exonic
1175083073 20:56437438-56437460 GGGGCCTGGAGTGGGAGGGCGGG - Exonic
1175141000 20:56860178-56860200 GGGGCTGAGAGGGGAGGGGCTGG - Intergenic
1175159165 20:56995281-56995303 GGAGATGGGAGTGAAAGGGCAGG - Intergenic
1175228569 20:57459688-57459710 GGGGCTGCGGGTGGAGGGTTGGG + Intergenic
1175491618 20:59384151-59384173 GGGGATGGGAGTGGAGTGGCGGG + Intergenic
1175674704 20:60936697-60936719 GGGGCGGGGGGTAGAAGGGCTGG - Intergenic
1175762637 20:61571782-61571804 GGGGCAGGGAGGGGAGGGGCGGG - Intronic
1175809166 20:61848274-61848296 GGGGCTGCTGGTGAAAGGTCAGG + Intronic
1175903494 20:62368981-62369003 GGGATTGCGAGTGGCGGGGCAGG + Intergenic
1176016785 20:62938085-62938107 GGGGCGGGGAGCGGGAGGGCAGG - Intergenic
1176077229 20:63254113-63254135 GGGGCAGCGGCTGGATGGGCTGG - Intronic
1176122093 20:63458544-63458566 GGGGCTGCCCGGGGAAGGGATGG - Intronic
1176952693 21:15065079-15065101 GGGGCGGCGAGGGGAGGGACTGG - Intergenic
1178424307 21:32467199-32467221 GGGGATGCCAGTTGAGGGGCTGG + Intronic
1179407549 21:41137959-41137981 GGGGCTGAGAATGGAAGAGGGGG - Intergenic
1179629206 21:42666287-42666309 GGAGCTGCCAGGGGCAGGGCTGG + Intronic
1179830667 21:43994178-43994200 GGGGCTGGGAGGGGACGTGCTGG - Intergenic
1179933545 21:44588989-44589011 GGGACTGAGAGGGAAAGGGCGGG + Intronic
1181343424 22:22200455-22200477 GGCGGGGCGGGTGGAAGGGCAGG - Intergenic
1181809240 22:25393301-25393323 CTGGCTGCGAGTGGAACAGCAGG - Intronic
1181967007 22:26663877-26663899 GGGGCTGAGAGGGGATTGGCTGG - Intergenic
1182295789 22:29310749-29310771 GGGGCTGGGGCTGGACGGGCAGG + Intronic
1182414196 22:30210478-30210500 GGGGCGGAAGGTGGAAGGGCCGG + Intergenic
1182521988 22:30889965-30889987 GGGGCTGTGTGTGGAGGGGTGGG + Intronic
1182667577 22:31970800-31970822 GAGGCTGCGCCTGGAAGGGAGGG - Intergenic
1183110984 22:35648502-35648524 GGGGCTGTGAGTGTCTGGGCTGG - Exonic
1183633331 22:39046426-39046448 GGGGCTGTGAGAGTCAGGGCAGG - Intronic
1183949265 22:41343616-41343638 GCGGCTGGGGGTGGAGGGGCTGG - Intronic
1184031856 22:41899888-41899910 GAGACTGGGAGTGGAAGGGGAGG - Intronic
1184096227 22:42317919-42317941 GGGGCTGCCAGGGGATGGACAGG - Intronic
1184100319 22:42338512-42338534 GGGGCTGCGAGTGGAAGGGCTGG + Intronic
1184206474 22:43007176-43007198 GGGGCTGCTAGGGGCAGGGAAGG - Intronic
1184224074 22:43119051-43119073 AGGGCTCCGAGTGGGAGGGAGGG - Intronic
1184363294 22:44031554-44031576 GGGGCTTGGGGAGGAAGGGCAGG + Intronic
1184523184 22:45007674-45007696 GGGGCTGCGCGGGGAAGGGGCGG + Intronic
1184791647 22:46703849-46703871 GGGGGTGGGGGTGGAGGGGCAGG - Intronic
1185058734 22:48594471-48594493 GGGGCTGGGATAGGGAGGGCTGG + Intronic
1185126156 22:49011915-49011937 GGGGCTGCGGGAGGATGGGAGGG - Intergenic
1185302479 22:50089820-50089842 GGGGCTTCGAGCGGGCGGGCGGG - Intergenic
1185311774 22:50160072-50160094 GGAGCAGAGAGTGGGAGGGCAGG + Intronic
949918644 3:8984694-8984716 TGGCCTCCGGGTGGAAGGGCAGG + Exonic
950260974 3:11543320-11543342 GGGGCTGGGGTTGGAAAGGCTGG + Intronic
950446700 3:13042777-13042799 GGGGCTCCGGGTGGTGGGGCCGG + Intronic
950457548 3:13101636-13101658 TGGGCTGCAGGCGGAAGGGCTGG + Intergenic
950793828 3:15494611-15494633 GAGGCTGCTTGTGGGAGGGCAGG - Intronic
951587457 3:24230017-24230039 GATGCTGTGAGTGGAAGTGCTGG + Intronic
952972062 3:38657592-38657614 GGGGCTGAGGGTGGAGGGGAGGG + Intergenic
953568907 3:44056478-44056500 AGGGCTGGGAGTGGAAGCCCAGG - Intergenic
953705407 3:45226413-45226435 GGGGCTGGGAGAGGAATCGCCGG + Intergenic
953754585 3:45635459-45635481 GGAGCTGCTGGTAGAAGGGCAGG + Intronic
954693979 3:52410480-52410502 GGGGCGGCGAACGGAAGGGGCGG + Intergenic
956616224 3:71175398-71175420 GGGGCTGCTATTGGAGAGGCAGG - Intronic
956744774 3:72302491-72302513 AGGGCTTGGAGTGGAAGGGAGGG + Intergenic
956745456 3:72307420-72307442 GGGGCTGAGAGAGGAAGAGCAGG + Intergenic
959910950 3:111763048-111763070 GGGGCTGCCTGTAGAAGTGCTGG - Intronic
959963998 3:112333291-112333313 CGGGCGGCGAGTGGAAGGCGCGG + Intronic
960050595 3:113235399-113235421 GGGGCTGGGAGTGGGAGTCCAGG + Intronic
960997554 3:123349988-123350010 GGGACAGCAGGTGGAAGGGCAGG - Intronic
961321069 3:126076646-126076668 GGGGCTCAGAGTGGAGAGGCTGG - Intronic
961353043 3:126316238-126316260 GGGGCTGGGAGTGCACGGGTGGG + Intergenic
961353059 3:126316290-126316312 GGGGAAGGGAGTGCAAGGGCTGG + Intergenic
961550955 3:127670401-127670423 GGGGCTGCTGGTGGAAGTGTGGG + Intronic
961636554 3:128336543-128336565 GGAACTGCGGGTGGCAGGGCTGG - Intronic
961760081 3:129160931-129160953 GAGGGAGCGAGTGGATGGGCGGG - Intronic
961818093 3:129561544-129561566 GAGGCTCCGAGAGGCAGGGCTGG - Intronic
962198041 3:133380184-133380206 GGGCCTGCGTGTGGTAGTGCGGG - Exonic
962498414 3:135965703-135965725 GGGCCTGCGGGTGGCTGGGCGGG + Exonic
964112173 3:153099048-153099070 GGGGCTGGGAGTGGGAAGACAGG - Intergenic
964474756 3:157088745-157088767 GGGGCGGGGAATGGGAGGGCTGG - Intergenic
966267856 3:178068403-178068425 GGGAATGGGAGAGGAAGGGCAGG - Intergenic
966675863 3:182589169-182589191 GTACCTGGGAGTGGAAGGGCTGG - Intergenic
966735424 3:183182970-183182992 AGGGCTGGGACTGGAAGGCCTGG - Intronic
967300136 3:188004635-188004657 GGGGCAGCAAGTTGAAGGGTGGG - Intergenic
967950431 3:194836218-194836240 TGGGCTGTGAGTTGGAGGGCAGG - Intergenic
968032404 3:195511632-195511654 GGGGCTGGGGAAGGAAGGGCTGG - Intergenic
968803231 4:2756410-2756432 GGGGCTGCGTGGGGGAGGGCGGG - Intergenic
968803248 4:2756447-2756469 GGGGCTGCGCGGGGAAGGGCGGG - Intergenic
968873521 4:3253545-3253567 GGGACTGGGAGTGGCAAGGCCGG + Intronic
969657112 4:8504796-8504818 GGGGCTGGCACTGGCAGGGCAGG - Intergenic
969823107 4:9735419-9735441 GGGGATGCCAGTTGAGGGGCTGG + Intergenic
969871169 4:10106093-10106115 GGGGGTGAGGGTGGAAGGGGTGG + Intronic
970235195 4:13951874-13951896 GTTGCTGCGAGTGGAAGTGATGG - Intergenic
970432920 4:16005611-16005633 GGGGCTGTGAGTGAGCGGGCTGG - Intronic
971571138 4:28212495-28212517 AGGGCTGTGGGTGGAAGGGTTGG - Intergenic
972709324 4:41578709-41578731 GGGGAGGGGAGTGGAAGGGAAGG - Intronic
973555370 4:52076799-52076821 ACGGCTGCGAGGGGCAGGGCTGG - Exonic
975728601 4:77316417-77316439 AGGGATGCTAGGGGAAGGGCAGG + Intronic
977694499 4:99950693-99950715 GGGGCTGGGAGTGGTGGGGGCGG - Intergenic
978736998 4:112094700-112094722 GGGGCTGCCAGAGGAAGGCAGGG + Intergenic
978763239 4:112378051-112378073 TGGGCTGCGGGCGGACGGGCAGG + Intronic
979140100 4:117162166-117162188 AGTGCTGGGAGTAGAAGGGCGGG + Intergenic
980896975 4:138869104-138869126 GGGGATGGGAGAGGAAGGGAAGG + Intergenic
981868091 4:149451180-149451202 GAGGCTGCGAAGGGAAGGGAAGG + Intergenic
983904411 4:173169149-173169171 GGGGCGGCGAGGGGGCGGGCCGG - Intronic
984708044 4:182862283-182862305 GGGGCCGGGAGAGGAATGGCAGG - Intergenic
985540717 5:486217-486239 GGGGCTGGGGGAGGATGGGCAGG + Intronic
985708369 5:1414440-1414462 GGGGCCGGGAGGGGCAGGGCGGG + Intronic
985775305 5:1838093-1838115 GGGGCTGGGAGACAAAGGGCAGG - Intergenic
987340665 5:16936347-16936369 GGGGCCGCGAGCGGGAGGGCGGG - Intergenic
989255775 5:39364479-39364501 GTGGCTGCGAGTGGGGTGGCAGG + Exonic
991666901 5:69008356-69008378 GGGGGTGGGAGTGGAAGGGAGGG - Intergenic
993538391 5:89117209-89117231 GGGGCAGGGACTGGGAGGGCAGG + Intergenic
995745053 5:115394137-115394159 GCAGCTGCAACTGGAAGGGCAGG + Intergenic
996837068 5:127805074-127805096 GGGACTGGGAGAGGGAGGGCAGG - Intergenic
996865640 5:128118557-128118579 GGGGATGCGGGTGGAAGGGTGGG + Intronic
998373103 5:141673579-141673601 GGTGCTGGGAGGGGAAGGGAGGG - Intronic
998395714 5:141816630-141816652 GGGGCTGCTCGGGGAAGGGGTGG - Intergenic
998529550 5:142872059-142872081 ATGGCTGCTAGTGGAAGAGCTGG - Intronic
999103956 5:149052592-149052614 GGGGCAGATAATGGAAGGGCTGG + Intronic
999370445 5:151052106-151052128 GGGGCTGCAGGAGGAGGGGCTGG - Intronic
999445076 5:151632747-151632769 CTGGCGGCGTGTGGAAGGGCGGG + Intergenic
1000532759 5:162444402-162444424 GGTGCTGGGAAGGGAAGGGCAGG + Intergenic
1001591796 5:172870732-172870754 GTGGCTGCGAGAGGGAGGGAAGG - Intronic
1001827943 5:174761348-174761370 GGGGCTGGGGGAGGAATGGCAGG - Intergenic
1002424494 5:179167242-179167264 GGGGCGGGCAGAGGAAGGGCCGG + Intronic
1002437117 5:179238469-179238491 GGGTCTGCGAGTGCCAGGGCAGG + Intronic
1002453533 5:179332715-179332737 GGGGATGGGAGAGGAAGGGAGGG + Intronic
1002456168 5:179346235-179346257 GGGGCCGGGAGTGCAATGGCGGG - Intergenic
1002467933 5:179417095-179417117 GGGGCTGGAAGCGGCAGGGCCGG + Intergenic
1002695672 5:181086702-181086724 GGGGCAGCGGGGGGAAGTGCGGG + Intergenic
1002782651 6:379379-379401 GGGTGTGCGGGTGGAGGGGCGGG - Intergenic
1002797705 6:488138-488160 GGGACTGATGGTGGAAGGGCTGG + Intronic
1003061352 6:2865274-2865296 GGGAGAGCGAGTGGAAGGGAGGG - Intergenic
1003175962 6:3752173-3752195 GGGGCTGCGAGTGTCGGGGCGGG + Intergenic
1003995665 6:11537724-11537746 GCGGCTGCGGGTGGAGGGGGCGG + Intergenic
1004562202 6:16761318-16761340 GGGGTTGCGTGGGGAAGGGGGGG + Exonic
1004667501 6:17761936-17761958 GGGGATGCGAGGGGATGGGGAGG + Intronic
1005610028 6:27514787-27514809 GAGGTTGAGAGTGGAAAGGCAGG + Intergenic
1005968226 6:30742406-30742428 GGAGCGGCGAGGGGAAGGGAGGG - Intronic
1006339883 6:33440990-33441012 AGGGCAGGGAGTGGCAGGGCAGG + Intronic
1006339888 6:33441005-33441027 AGGGCAGGGAGTGGCAGGGCTGG + Intronic
1006535546 6:34696383-34696405 GGGGCCCCGAGGGGAAGGGAAGG - Intronic
1006854599 6:37124129-37124151 GGGGAAGGGAGTGGAAGGGGAGG + Intergenic
1007047886 6:38796206-38796228 GGGGCTGGCTCTGGAAGGGCTGG - Intronic
1007178792 6:39913704-39913726 GGGGCGGTGAGGGGAAGGCCAGG + Intronic
1007336650 6:41159508-41159530 GGGGCTGCCAGGGGAGGGGCGGG + Intronic
1007363228 6:41373216-41373238 GGAGCTGCGGGTGGCAGGGTCGG + Intergenic
1007423892 6:41735009-41735031 GGAGCTGGGAGTCGAAGGGGCGG - Intronic
1007705366 6:43787533-43787555 GGGGCAGGGAGTGGGTGGGCAGG + Intergenic
1008444078 6:51568237-51568259 GGGGATGGGAGTGGCAGGGAGGG + Intergenic
1008587612 6:52963522-52963544 GGGGCTGCAACTAGAAGTGCTGG - Intergenic
1010001997 6:70957173-70957195 GGGGCTGCGAGAGGGAGGCGCGG + Intergenic
1010590248 6:77703909-77703931 GGGACTGTGAGTGTGAGGGCGGG + Intronic
1011558932 6:88595827-88595849 GGGGCTGTGAAAGGAGGGGCTGG + Intergenic
1013079691 6:106801447-106801469 GGGGGTGCGGGTGAGAGGGCTGG + Intergenic
1015366422 6:132401679-132401701 GGGGCTGCAAGTGGATCCGCTGG - Intergenic
1015729539 6:136334350-136334372 GGTGCTGGGAGGAGAAGGGCAGG + Intergenic
1016057780 6:139596731-139596753 GGGTCTGTGAGAGGAAGGGCTGG + Intergenic
1016225080 6:141724898-141724920 GGGGGTGGGAGTGGGAGGGGTGG + Intergenic
1016594992 6:145788942-145788964 GGGGCTGCCAGTGTGAGTGCAGG - Intergenic
1016840106 6:148517263-148517285 GGAGCTGTGAGTGGCAGAGCCGG + Intronic
1017096762 6:150811734-150811756 GGGGCAGGGACGGGAAGGGCAGG + Intronic
1017300018 6:152846184-152846206 GAGGCTGGGAGTGGAAGGCATGG + Intergenic
1017542659 6:155418571-155418593 GGGGCGGGGAGTGGAAGGGGAGG - Intronic
1018787531 6:167119903-167119925 GGTGCTGAGAGTGGAGGGACAGG - Intergenic
1019112977 6:169732430-169732452 GGGGGTGAGAGTGGAGGGGAGGG - Intergenic
1019614920 7:1954866-1954888 GGGGCTGGAAGTGGGTGGGCGGG - Intronic
1019712136 7:2522601-2522623 GGGGCTGCAGGAGGAAGAGCCGG - Intronic
1019728632 7:2617355-2617377 GGGCCTGGGAAGGGAAGGGCTGG - Intergenic
1019890297 7:3941041-3941063 GGGTCTGGGAGTGGCAGTGCTGG - Intronic
1020400562 7:7771787-7771809 GGGGGTGAGAGTGGAGGGGCTGG + Intronic
1020469044 7:8514799-8514821 GGGGAGGTGAGTGGAGGGGCAGG - Intronic
1021082932 7:16384805-16384827 TGGGGTGGGAGGGGAAGGGCAGG + Intronic
1023959282 7:44913137-44913159 GGGGTTGGGGGTGGGAGGGCAGG - Intergenic
1026803919 7:73417904-73417926 GGGGCTGGGAGAGCAATGGCAGG + Intergenic
1026841435 7:73671550-73671572 GGGGCTGGGGGTGGGTGGGCAGG + Exonic
1027146213 7:75696555-75696577 GGGGAGGCGAGGGGAAGGGAGGG - Intronic
1028477090 7:91264824-91264846 GGGGCTGCCAGGGGCACGGCCGG - Exonic
1028718752 7:94004569-94004591 CGGGCTGCGAGCGGAACAGCGGG - Intergenic
1029306724 7:99625102-99625124 GGGTCAGCAAGTGGAGGGGCAGG - Intronic
1029483622 7:100826895-100826917 GGGCCTCGGAGTGGAGGGGCCGG - Intronic
1030152527 7:106421226-106421248 GGGGCAGTGAGTGGAAGGCCTGG + Intergenic
1032085199 7:128880125-128880147 GGGTCTGCGAGAGGCATGGCGGG - Intronic
1032218872 7:129978856-129978878 GGGGGTGGGTGTGGGAGGGCAGG - Intergenic
1033418669 7:141186415-141186437 GAGGCCCCGAGAGGAAGGGCAGG - Intronic
1033705573 7:143882648-143882670 GGTGCTGCGGGGGGGAGGGCAGG - Intronic
1034255468 7:149722482-149722504 GGGGCTATGGGTGGGAGGGCTGG - Exonic
1035197363 7:157233046-157233068 AGGGCTGGGGGAGGAAGGGCAGG - Intronic
1036002790 8:4626615-4626637 GGGGCAGGGTGTGGGAGGGCAGG + Intronic
1037818308 8:22123618-22123640 GGGGCTGGGGGTGGGAGGGCGGG - Intronic
1037835931 8:22214688-22214710 GGGGCTGGGAGTGTAGGGTCGGG - Intergenic
1037881028 8:22573595-22573617 GGAGCTGGGCCTGGAAGGGCAGG + Intronic
1037883125 8:22582434-22582456 GGGTCTGGCAGCGGAAGGGCAGG + Intronic
1039200907 8:35092559-35092581 AGGGCAGAGAGTGGCAGGGCTGG + Intergenic
1040987303 8:53309906-53309928 GGGTTGGGGAGTGGAAGGGCAGG - Intergenic
1041375165 8:57204877-57204899 GGGGGTGCGGGTGGCAGCGCAGG + Intergenic
1042039625 8:64578143-64578165 GGGGCTGTGAGCGGCAGAGCCGG - Intergenic
1042987917 8:74604355-74604377 TGGGCTGGAAGGGGAAGGGCGGG + Intronic
1043794281 8:84516038-84516060 GGGGCTGAGAGTGGGAGAGGTGG + Intronic
1044794778 8:95885706-95885728 TGGGCTGCCAGTTGGAGGGCTGG - Intergenic
1044822130 8:96161548-96161570 GGGACTGCGAGAGGAGAGGCTGG - Intergenic
1044996890 8:97845857-97845879 GGGGAGGGGAGTGGAAGGGGGGG - Intronic
1045115189 8:98973722-98973744 GGGGCTGCCAGGGGAGGGGTGGG - Intergenic
1045188395 8:99860268-99860290 GGGACTGTGGGTGGGAGGGCTGG + Intronic
1045511813 8:102817424-102817446 AGGGCTGGGAGTGGACGTGCAGG + Intergenic
1046671841 8:117064772-117064794 GGGGCTGGGTGAGGAGGGGCTGG - Intronic
1047373483 8:124275258-124275280 GGGGCTGCAGGTGGAATGGGTGG - Intergenic
1047797026 8:128267997-128268019 GAGGGTGGGAGTGGGAGGGCAGG - Intergenic
1049203278 8:141351989-141352011 GGGGCTGCGGCTGGAGGGCCAGG - Intergenic
1049223988 8:141440988-141441010 AGGGCTGGGAGTGGGAAGGCAGG + Intergenic
1049251035 8:141589072-141589094 GGGGCTGGGCGTGCAAGTGCTGG - Intergenic
1049272122 8:141701416-141701438 GGGGCTGGGCATGGCAGGGCCGG - Intergenic
1049725338 8:144143132-144143154 GGGGCTGGCTGTGGTAGGGCAGG + Intergenic
1049759048 8:144323671-144323693 GGGGCTGCAGGAGGGAGGGCAGG - Intronic
1049797339 8:144502848-144502870 AGGGATGCTAGGGGAAGGGCAGG - Intergenic
1049820364 8:144629753-144629775 GGGGCTGCGACAGGAAGAGGAGG + Intergenic
1050526857 9:6553789-6553811 GGGGCTGGGAGTGGGAGGGAGGG - Intronic
1051809319 9:21031660-21031682 GCGGCTGGGCGCGGAAGGGCGGG + Intergenic
1053415766 9:37945905-37945927 GGAGCAGCGAGTGGCAGGACAGG + Intronic
1053420721 9:37975838-37975860 GGGCCTGGGAGTGGCAGGGCAGG + Intronic
1056848346 9:90059399-90059421 GGGGCTGGGAGAGGCAGGGAAGG + Intergenic
1057078288 9:92152636-92152658 GGGGATGAGAAAGGAAGGGCAGG + Intergenic
1058022505 9:100103694-100103716 GGGGAGGCGAGGGGAAGGGAGGG + Intronic
1059328659 9:113520597-113520619 GAGGCTGGCAGGGGAAGGGCTGG - Intronic
1059691225 9:116687541-116687563 GGGGCTGCGAGGGGCAGGCTCGG + Intronic
1059726600 9:117014501-117014523 AGAGCTGGGAGTGGAAGGTCAGG - Intronic
1060004204 9:119985358-119985380 GGGTCTGCAAATGGATGGGCTGG - Intergenic
1060004991 9:119991985-119992007 GGGGCTGAGAGGGTAAGGGCAGG + Intergenic
1060192024 9:121599482-121599504 GGGCCTGCGATTGGCAGGGCTGG + Intronic
1060524673 9:124313779-124313801 GGGGCTGGGAGTGCAGGGGGGGG + Intronic
1060700895 9:125747903-125747925 CGGGCTGCGAGGGGCAGGACGGG - Intronic
1060803440 9:126558961-126558983 GTGACTGGGAGTGGAAAGGCAGG - Intergenic
1060995565 9:127873478-127873500 GGGCCTGAGAGGGGAAGGGCAGG - Intronic
1061092017 9:128431858-128431880 GGGGCTGGGAGTGTGAGCGCAGG + Intronic
1061165627 9:128920627-128920649 GGGGCTCCCAGGGGAATGGCTGG + Intergenic
1061218097 9:129233452-129233474 GAGGCTGAGAGTGGGAGTGCAGG + Intergenic
1061262977 9:129490141-129490163 GGGGCTGGGAGGGACAGGGCAGG - Intergenic
1061267264 9:129514123-129514145 GCAGCTGCGCCTGGAAGGGCAGG - Intergenic
1061275696 9:129568638-129568660 AGGGCTGCGAGCACAAGGGCTGG + Intergenic
1061590303 9:131593681-131593703 GGGGCTGCGTGGGGTGGGGCTGG + Intronic
1061840534 9:133356405-133356427 GGGGCTGCGGGCGGCGGGGCTGG - Exonic
1061967629 9:134025233-134025255 GGAGCTGGGAGAGGAGGGGCTGG - Intergenic
1062219891 9:135409495-135409517 GGGACTGCGGGTGGAACGGGTGG + Intergenic
1062284702 9:135767836-135767858 GGGCCTGGGGGAGGAAGGGCAGG + Intronic
1062474361 9:136719963-136719985 GGGGCTCCGGGTGCAGGGGCTGG + Intronic
1062503252 9:136860192-136860214 GTGGCTGGGAGAGGCAGGGCAGG - Intronic
1062538357 9:137030668-137030690 GTGGGTGTGGGTGGAAGGGCTGG - Exonic
1186555727 X:10556325-10556347 GGGGATGCGGGTGGCAGGGGTGG - Intronic
1187915753 X:24150487-24150509 GGGGCTGCGGGAGGCAAGGCAGG - Intronic
1188806391 X:34595571-34595593 GAGGCTGGGAGTGGGAGGACAGG + Intergenic
1189232935 X:39466176-39466198 GGGGCTGTGAGTAGGAGGCCAGG - Intergenic
1189281283 X:39821457-39821479 GGGGCTGAGGGTGGGAGCGCGGG + Intergenic
1190726352 X:53193099-53193121 GGGGCTGCCAGTGGTGGGGATGG + Exonic
1191783855 X:64896716-64896738 GGGGACTCGAGTGGAAGGGCAGG - Intergenic
1192180893 X:68914856-68914878 GGAGCTGCGAGTGGGGGGGTAGG + Intergenic
1193037846 X:76972762-76972784 GGGGCTGTGGGAGGCAGGGCAGG + Intergenic
1196210096 X:112986414-112986436 GGGGATGGGAGGGGAAGGGAGGG + Intergenic
1196429556 X:115608201-115608223 GGGGCTGGAAGTGGTAGGGAGGG - Intronic
1197707808 X:129646874-129646896 GTGGCTGGGAGGGGAAGGGAAGG - Exonic
1197833657 X:130672312-130672334 GTGGCTGCGATAGGGAGGGCAGG - Intronic
1199277090 X:145957920-145957942 GGGGGAGAGAGTGGAAGGGAAGG + Intergenic
1199364022 X:146957227-146957249 GGGGCTCCGAATGGAGGGACCGG + Intergenic
1199600755 X:149540062-149540084 GGGGCAGGGAGGGGAGGGGCGGG - Intergenic
1199601945 X:149546302-149546324 GGTGCTGTGAGTGGTGGGGCTGG - Intronic
1199648441 X:149933182-149933204 GGTGCTGTGAGTGGTGGGGCTGG + Intronic
1199969735 X:152850926-152850948 GGGGCTGGGAGGGGAAGAGAGGG - Intronic
1200017691 X:153179153-153179175 GGGGGTGAGGGTGGAATGGCTGG - Intergenic
1200054937 X:153455395-153455417 GGGGCTGGGAGGGGCTGGGCTGG - Intronic
1200084884 X:153599186-153599208 GGGGCGGCGAGGGGCGGGGCGGG - Exonic
1200084894 X:153599206-153599228 GGGGCGGCGAGGGGCGGGGCGGG - Intronic
1200084904 X:153599226-153599248 GGGGCGGCGAGGGGCGGGGCGGG - Intronic
1200323827 X:155216826-155216848 GGGGCGGCGGGTGGCAGGGCAGG + Intronic
1201671898 Y:16531464-16531486 GAGGCTGAGAGAGGAAGGGAAGG - Intergenic