ID: 1184100320

View in Genome Browser
Species Human (GRCh38)
Location 22:42338513-42338535
Sequence GGGCTGCGAGTGGAAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 376}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100315_1184100320 -6 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 376
1184100304_1184100320 30 Left 1184100304 22:42338460-42338482 CCGGCAGCCCGGCCTGCAGGGGC No data
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 376
1184100310_1184100320 0 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 376
1184100308_1184100320 18 Left 1184100308 22:42338472-42338494 CCTGCAGGGGCCACTCGGCCAAT 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 376
1184100307_1184100320 22 Left 1184100307 22:42338468-42338490 CCGGCCTGCAGGGGCCACTCGGC 0: 1
1: 0
2: 3
3: 27
4: 248
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 376
1184100314_1184100320 -5 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 376
1184100305_1184100320 23 Left 1184100305 22:42338467-42338489 CCCGGCCTGCAGGGGCCACTCGG 0: 1
1: 0
2: 2
3: 44
4: 302
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 376
1184100309_1184100320 8 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100320 Original CRISPR GGGCTGCGAGTGGAAGGGCT GGG Intronic
900127483 1:1075048-1075070 GGGCTGAGGCTGGCAGGGCTGGG + Intergenic
900410442 1:2510225-2510247 GGCCTTCGAGTGGCTGGGCTGGG + Intronic
900886737 1:5420711-5420733 GGGCTGCAGGTGGAAGGTCAGGG + Intergenic
901721280 1:11200013-11200035 GGGGGGCGAGTGGCAGGGCGGGG + Intronic
901780915 1:11594032-11594054 GGGATGCTTGTGGAAGGGGTGGG - Intergenic
901786759 1:11629904-11629926 AGGCTGAGATGGGAAGGGCTAGG - Intergenic
901800772 1:11706719-11706741 GGGCTGCGAGGGGTGGGGATGGG + Intronic
902389623 1:16095587-16095609 GGGATGGGAATGGAAGGGCATGG - Intergenic
903153739 1:21430390-21430412 TGGCTCAGACTGGAAGGGCTGGG + Intergenic
903164078 1:21509126-21509148 TCGCTGAGAGAGGAAGGGCTGGG + Intergenic
903811361 1:26036663-26036685 GGGGTGGGGGTGGAAGGCCTTGG - Intergenic
904068332 1:27772994-27773016 GGGCTGAGATTGGATGAGCTTGG - Intergenic
904696861 1:32335900-32335922 GAGGTGCGAGAGGAGGGGCTGGG + Intronic
905274109 1:36806072-36806094 GGGCTGCCTGTGGGAGGGGTGGG - Intronic
907284356 1:53370562-53370584 GGGCTGGCAGTGGGAGGGCTGGG + Intergenic
907403322 1:54238925-54238947 GGGGTGGGAGAGGAAGGGGTGGG - Intronic
909352670 1:74673378-74673400 GGGGAGCGAGGGGGAGGGCTGGG - Intronic
910840607 1:91557431-91557453 TGGCTGCAAGTGGTAGAGCTGGG - Intergenic
911230256 1:95353549-95353571 TGCCTGAGAGTGGATGGGCTTGG + Intergenic
911659837 1:100488982-100489004 GGGCTGAGGGTGGAAGGCCAGGG + Intronic
911720965 1:101190678-101190700 GAGCTGCTGGTGGAAAGGCTGGG + Intergenic
912969820 1:114270198-114270220 GAACTGTGAGTGGCAGGGCTTGG + Intergenic
913192673 1:116426620-116426642 GGGATGCCCGTGGAAGGGCATGG - Intergenic
913533080 1:119746986-119747008 GAGCTGCCAGAGGAAGGCCTCGG + Intergenic
914996359 1:152546423-152546445 TGGCTGTGATGGGAAGGGCTGGG - Intronic
915064774 1:153215769-153215791 GGCCTGAGAGTGGAAGGACTTGG - Intergenic
915558054 1:156670862-156670884 GGGCAGGGGGTGGGAGGGCTGGG - Exonic
915629689 1:157142629-157142651 GGGCTGCCAGTGGGAAGGCAGGG - Intergenic
915978721 1:160407367-160407389 GGGATGAGGGTGGCAGGGCTGGG - Intronic
917193534 1:172443801-172443823 GGGCTGGGAGGGGACGGGGTAGG + Exonic
917677549 1:177334137-177334159 TGGCTGCAAGGGAAAGGGCTTGG + Intergenic
918039873 1:180907555-180907577 GAGCTGAGTGTGGAAGGTCTAGG + Intergenic
918138608 1:181700781-181700803 GGACAGCGAGTGGAAAGGCCAGG + Intronic
920045220 1:203128345-203128367 GGGCCGCGCGCGGTAGGGCTGGG - Intronic
920313124 1:205060006-205060028 GGTCTGCGGGTGGCAGAGCTGGG - Intronic
920679290 1:208060364-208060386 GGGCTGACAGGGGAAGGGCTGGG + Intronic
922412906 1:225392965-225392987 GGCGTGGGAGTGGCAGGGCTGGG - Intronic
922619910 1:226983070-226983092 GGGCTGCAAGGGGCAGAGCTGGG + Intronic
923629168 1:235638389-235638411 GGGCTGTGGGTGGAAGCTCTGGG + Intronic
1063238905 10:4148084-4148106 GGCCTGAGAGTGGAGGGGGTGGG + Intergenic
1065009169 10:21406091-21406113 GCGCTGAGAGTGCAGGGGCTTGG + Intergenic
1065204469 10:23344133-23344155 GGGCCGCGAGTGGAGGGGGGTGG + Intronic
1069605532 10:69736747-69736769 GGCCTGGGAGAGGGAGGGCTGGG - Intergenic
1069691324 10:70354898-70354920 TGGCTGATAGTGGAGGGGCTGGG - Intronic
1069891773 10:71656595-71656617 GGGCGGGGAGTGCCAGGGCTGGG + Intronic
1073476823 10:103759151-103759173 GGGCTGGGAGAGGAAGGCCCCGG + Intronic
1074454586 10:113586257-113586279 GGGTGGCCAGTGGCAGGGCTGGG + Intronic
1074641007 10:115380531-115380553 GGGCTACCAGAGGCAGGGCTGGG - Intronic
1076256143 10:129026060-129026082 GGGCTGGGAGTGGGTGGGATGGG + Intergenic
1076764812 10:132627276-132627298 GGGCTGAGGGTGGACAGGCTGGG + Intronic
1077051305 11:568267-568289 GGGCTGCGGGGGGTCGGGCTGGG - Intergenic
1077082950 11:733426-733448 GGGCTGCCCGGGGAAGAGCTGGG + Intergenic
1077174003 11:1180591-1180613 GGGCTGGGAGCGGCAGGGCTGGG + Intronic
1077240599 11:1508530-1508552 GGGCTGTGAGGGGGAGGGCAGGG - Intergenic
1077331886 11:1987473-1987495 GGGCTGGGAAGGGCAGGGCTGGG + Intergenic
1077413377 11:2413705-2413727 GGGCTCCGGGAGGGAGGGCTGGG - Intronic
1077478629 11:2802786-2802808 GGACTGTGAGGTGAAGGGCTGGG - Intronic
1077536677 11:3127968-3127990 GGGTGGGGAGGGGAAGGGCTGGG - Intronic
1077555760 11:3225358-3225380 GGGTTGCGGGTGGATGGGGTGGG + Intergenic
1078245440 11:9570113-9570135 GGGCTGGGATTTGAAGGGATAGG + Intergenic
1078852105 11:15173406-15173428 TGGCTGAGATTGGAAGGGGTGGG + Intronic
1078946204 11:16071150-16071172 TGGCTACCAGTGGAAGGGTTTGG - Intronic
1080697894 11:34619176-34619198 AGGGTGGGAGTAGAAGGGCTAGG - Intergenic
1081352021 11:42065985-42066007 GGGCTGCGAAAGGAAGGGCATGG + Intergenic
1081807092 11:45896640-45896662 GGGCTGCGCTGGGAAGAGCTGGG + Intronic
1083304375 11:61754918-61754940 GGCCTGGGAGTGGCAGGGCCTGG + Intronic
1083767271 11:64847562-64847584 GGGCTGCACGGGGCAGGGCTGGG + Intergenic
1083947824 11:65934948-65934970 AGGCTGAGAGTGTAAGGTCTTGG - Intergenic
1084411983 11:69010751-69010773 GGGCTGCCAATGGGAGGCCTGGG + Intronic
1084637094 11:70399288-70399310 GGGGTTCGAGGGGAAGGGGTCGG + Intronic
1084691948 11:70732680-70732702 GGGCTGCGTGGGCATGGGCTGGG - Intronic
1084913765 11:72412080-72412102 GGGCTGGGAGGGGCAGGGCAAGG + Intronic
1084988725 11:72902558-72902580 AGGCTGGAACTGGAAGGGCTGGG + Exonic
1087799654 11:102489661-102489683 GGGCTGCAGGTGGCAGGGGTGGG + Intronic
1089534028 11:119149731-119149753 GGGCTTCAAGGGGACGGGCTGGG + Intronic
1090334432 11:125953356-125953378 GGCCGGCTAGTGGGAGGGCTTGG - Intergenic
1091329026 11:134716040-134716062 TGGCTGAGAGTGCATGGGCTGGG - Intergenic
1202814867 11_KI270721v1_random:42649-42671 GGGCTGGGAAGGGCAGGGCTGGG + Intergenic
1091401920 12:186307-186329 TGGCTGCCGGTGGAAGGCCTCGG - Intergenic
1091969951 12:4778883-4778905 TGGCTGTGAGAGGCAGGGCTGGG + Intronic
1091974569 12:4814064-4814086 GGGCTGGGAGTGCCAGGGCACGG + Intronic
1095295839 12:40526612-40526634 AAGCTGTGAGTGGAAAGGCTGGG - Intronic
1095953493 12:47794212-47794234 GGGCTGTGAGTGTGAGGGCAGGG - Intronic
1096156292 12:49343072-49343094 GGGCTGCGAGTGGACGTGCCGGG + Intergenic
1096849536 12:54426871-54426893 GGGGTGGGAGTGGGAGGGCAGGG - Intergenic
1098939657 12:76519463-76519485 GGGCTGTGATTGGAAGTGTTTGG - Intronic
1099096970 12:78386569-78386591 GGAGTGGGAGTGGAAGGGATGGG - Intergenic
1104581420 12:130013922-130013944 GGGCTGGGAGTGGCAGGATTAGG + Intergenic
1104894984 12:132159600-132159622 GGGCTGGGCGTGGAAGGGCGGGG + Intergenic
1107450076 13:40500370-40500392 GGGCAGCGACTGCAAGGGATAGG - Intergenic
1107624872 13:42272109-42272131 GGGCTGGGAGGGGGAGGGCTGGG + Intergenic
1111745638 13:92265675-92265697 GGGCAGAGACTGAAAGGGCTTGG - Intronic
1113391617 13:109903324-109903346 GGAGTGCGGGAGGAAGGGCTGGG + Intergenic
1113946126 13:114044536-114044558 GGGCTGCCGGTGGGAGGGCGGGG - Intronic
1113978521 13:114251286-114251308 TGGCTGGGAGTGGAAGAGCCAGG - Intronic
1114426726 14:22629957-22629979 GGGCTGAGAATGGAACTGCTAGG + Intergenic
1117866862 14:60159003-60159025 GTGCTGGGAGAGGAAGGGATGGG - Intronic
1119480044 14:74953390-74953412 GGGCGGGGAGTGGAGGGGCCAGG + Intronic
1121322442 14:92999889-92999911 GGGCTGAGAGTGAAAGGGAATGG - Intronic
1121414984 14:93773299-93773321 GAGCTAGGAGTGAAAGGGCTGGG + Intronic
1121564697 14:94900467-94900489 GGGCTGGGAGTGGACGGGAATGG + Intergenic
1121713837 14:96058797-96058819 GGGCTGCCACTGGCAGGGCTGGG + Intronic
1122633554 14:103119196-103119218 GGGCTGCTGGGGGAGGGGCTAGG + Intergenic
1123084105 14:105709542-105709564 GGGCTGGGATGGGATGGGCTAGG - Intergenic
1124559666 15:30759812-30759834 GGGCTGCGTGTGGGAGAGCCAGG + Intronic
1124822255 15:33058013-33058035 GGGCTGGTAGTGGAAAGGCGTGG + Intronic
1127617497 15:60701623-60701645 GTGCTGCGGGTGGAGGGCCTGGG - Intronic
1128612352 15:69084267-69084289 CTGCTGGGAGTGGAAGGGCAAGG - Intergenic
1128920098 15:71602709-71602731 GGGCTGGGAGTAGAAGGGAATGG + Intronic
1129063544 15:72881122-72881144 GGGCTGCTAGTGCAAGTCCTGGG + Intergenic
1129189906 15:73931129-73931151 GGGGTGCGAGGGTAAGGCCTTGG - Intronic
1129394425 15:75236277-75236299 GGGTGGCCTGTGGAAGGGCTTGG - Intergenic
1129698088 15:77752046-77752068 GGCCTGCAAGTGGCAGGGCTGGG + Intronic
1129702188 15:77774410-77774432 GGGCTGGGAGTGGAATTGGTGGG - Intronic
1130327764 15:82895460-82895482 GGGCTGAGAGTGGCACAGCTGGG - Intronic
1131075433 15:89492411-89492433 GGGCTGCGAATGGGAGGGGGAGG - Intronic
1132554121 16:565172-565194 GGGCTGCGAGGGGGAGCCCTGGG - Exonic
1134114431 16:11537488-11537510 GGGCTGGGAGTGGCAGGGAGAGG + Intergenic
1135510812 16:23081491-23081513 GGGCTGCTAGTAGATGGGATAGG - Intronic
1135607219 16:23835650-23835672 GGGGAGCGGGTGGAAGGGGTGGG - Intergenic
1136429167 16:30186946-30186968 GTGCTGCGGGAGGAGGGGCTTGG + Intronic
1136448657 16:30339788-30339810 GGGCTGAGCGTGGCTGGGCTGGG + Intergenic
1137725540 16:50654252-50654274 TGGCTGGGAGTGGAAGTGCCTGG + Intergenic
1138238632 16:55407692-55407714 GGGCAGAGAGTGGATGGGTTGGG + Intronic
1138659765 16:58510118-58510140 GGGCTGCCTGTGGGAAGGCTGGG + Intronic
1138849241 16:60605980-60606002 GTGCTGCGAAGGGAAGGGCATGG - Intergenic
1139599986 16:67980598-67980620 GCGCTGGGGGTGGAAGGGCGAGG - Exonic
1141252074 16:82368211-82368233 GGGCTGTGAGTGCCAGGTCTGGG + Intergenic
1141291185 16:82719391-82719413 GGACAGCCAGTGGAAGGGCCTGG - Intronic
1141628806 16:85275807-85275829 GGCCTGGGAAGGGAAGGGCTTGG + Intergenic
1142007185 16:87695064-87695086 GGCCTGGGAGTGGAACTGCTGGG + Intronic
1142480295 17:214827-214849 TGGCTGTGGGTGGCAGGGCTGGG + Intronic
1142598236 17:1039923-1039945 GGGCTGTGAGTGCCAGGGCAGGG + Intronic
1142805392 17:2368669-2368691 GGGCTCATATTGGAAGGGCTGGG - Intronic
1142808747 17:2385560-2385582 GGGCTGAGCGTGGAAGGGGGAGG - Exonic
1142994117 17:3750924-3750946 GGGCTGGGAGTGGGATGGCAAGG + Intronic
1143156622 17:4841348-4841370 GGGATGGGATTTGAAGGGCTTGG + Intronic
1144750862 17:17647162-17647184 GGGCTGCAGGGGGAAGGGATGGG + Intergenic
1144767804 17:17742233-17742255 GGGCTGGGAGTGGACAGGCCAGG - Intronic
1145094203 17:20009955-20009977 GGGGTGACAGGGGAAGGGCTAGG + Intronic
1145283243 17:21483722-21483744 GGGCTGGGAGTGGAGGGGATGGG + Intergenic
1145394240 17:22482078-22482100 GGGCTGGGAGTGGAGGGGATGGG - Intergenic
1147258998 17:39197738-39197760 GGGCTGCGAGGGGCGGGGCCGGG - Intergenic
1147331726 17:39703250-39703272 GGGCTGCGGCTGGGAGGGCTGGG + Intronic
1147443718 17:40462484-40462506 GGGGCTTGAGTGGAAGGGCTGGG + Intergenic
1147978726 17:44262098-44262120 GGGCTGGGGGTGGGAGGGGTGGG - Intronic
1148079160 17:44957972-44957994 GGGGTGGAAGTGGAAGGGCTGGG + Intergenic
1148178588 17:45587128-45587150 GGGCTGGGAGGGGGAGGGCAAGG - Intergenic
1148270565 17:46259327-46259349 GGGCTGGGAGGGGGAGGGCAAGG + Intergenic
1148690632 17:49524970-49524992 GGGCTGGGAGTGGAGGGGAGGGG - Intergenic
1149038282 17:52158538-52158560 GGGCGCCGAGGGGAAGGGCTGGG + Exonic
1149556212 17:57575197-57575219 GGGCTGCTTGTGGAGGGGATGGG - Intronic
1150879869 17:69012453-69012475 GGACTGTCAGTGGAGGGGCTAGG + Intronic
1151229931 17:72677224-72677246 GGGGTGGGAGTTGCAGGGCTGGG + Intronic
1151292947 17:73163685-73163707 TGTATGCAAGTGGAAGGGCTGGG - Intergenic
1151559475 17:74862755-74862777 GTGTTGGGAGGGGAAGGGCTGGG - Exonic
1151572695 17:74935218-74935240 GGGCTGGGAGAGGGAGGGCTGGG + Intergenic
1151598292 17:75091094-75091116 GGCCTGGGAGTGCCAGGGCTAGG + Intronic
1151668450 17:75558643-75558665 GGGCTGGGAGTGGAAGGGGCTGG - Intronic
1151876828 17:76871672-76871694 GGGCGGGGAGTGGAGGGGCAAGG + Intronic
1152006967 17:77688428-77688450 GGGCTGGGGGTGGGAGGGGTTGG + Intergenic
1152336134 17:79701098-79701120 GGGGTGCAAGTGGGAGGGTTGGG + Intergenic
1152385265 17:79970269-79970291 GGGCTGGGGAAGGAAGGGCTGGG + Intronic
1152520463 17:80853059-80853081 GGGAGGCGAGTGGAAGGGGGTGG - Intronic
1152670347 17:81600486-81600508 GAGCTGGAAGTGGAAGGGCTTGG - Intronic
1152799762 17:82325369-82325391 CGGCTGCGTGAGGAAGGGCAGGG + Intronic
1152906420 17:82972954-82972976 GGGCTGTGAGCGGAAGGGGCTGG + Intronic
1154334883 18:13457307-13457329 GGGCTGCGTGGGGCAGGGCATGG + Intronic
1156488399 18:37481326-37481348 GGGCTGGCAGGGGAAGAGCTGGG - Intronic
1157149785 18:45205164-45205186 GTGCTGCTAGGGGAAGGTCTGGG - Intergenic
1158404978 18:57152854-57152876 GGGCTGAGATGGGAAGGGGTTGG + Intergenic
1160089578 18:75813841-75813863 GAGCTGTGAGTGGAGGGGATAGG - Intergenic
1160443679 18:78911824-78911846 GGGATGGGAGTTGAAGGGCCTGG - Intergenic
1161207858 19:3051204-3051226 GGGCTGGGAGTGGAGGGGACAGG - Intergenic
1161256274 19:3311587-3311609 GAGGGGCGAGGGGAAGGGCTGGG - Intergenic
1162034443 19:7931641-7931663 GGGCAGCGAGAGGGAGGGGTGGG + Intronic
1162340939 19:10091396-10091418 GGGCAGGGAGGGGCAGGGCTGGG - Intronic
1162395668 19:10416988-10417010 GAGGTGCGAGAGGAGGGGCTTGG + Intronic
1163462654 19:17448314-17448336 GGGCTGCGCGCCGAGGGGCTGGG - Exonic
1163775410 19:19214414-19214436 AGGGTGCGAGTGGAAGGGAGTGG + Intronic
1164558111 19:29269017-29269039 GGGCTCTGTGTGGAAGGGCGAGG + Intergenic
1164981687 19:32619234-32619256 AGGCTTCCAGAGGAAGGGCTGGG - Intronic
1165040545 19:33064950-33064972 GGGGTGGGAGTGGAGGGGCGGGG - Intergenic
1165421957 19:35726547-35726569 GTGGTGGGAGTGGAAGGCCTGGG + Intronic
1165834038 19:38743732-38743754 GGTCTGAGGGAGGAAGGGCTGGG - Intronic
1166297124 19:41894837-41894859 GGTCTGAGGGAGGAAGGGCTGGG + Intronic
1166305479 19:41934868-41934890 GGTCTGAGAGAGGAGGGGCTGGG + Intergenic
1166306317 19:41938660-41938682 GGTCTGGGAGAGGAAGGTCTGGG - Intergenic
1166306514 19:41939215-41939237 GGTCTGGGAGAGGAAGGTCTGGG - Intergenic
1166521914 19:43486478-43486500 GGTCTGAGGGTGGAGGGGCTGGG + Intronic
1166523192 19:43495068-43495090 GGTCTGAGAGAGGAGGGGCTGGG + Intronic
1166525626 19:43507857-43507879 GGTCTGAGAGAGGAGGGGCTGGG - Intronic
1166525637 19:43507894-43507916 GGTCTGAGAGAGGAGGGGCTGGG - Intronic
1166644299 19:44519822-44519844 GTGCAGCCTGTGGAAGGGCTGGG - Intronic
1166662166 19:44654213-44654235 GGACTGAGAGAGGAGGGGCTGGG + Intronic
1166834787 19:45660722-45660744 GGGGTGGGTGTGGAAAGGCTGGG + Intergenic
1166874901 19:45891135-45891157 GGGGTGGCAGTGGAGGGGCTGGG + Exonic
1166895374 19:46019063-46019085 GTGCTGGGAGGGGAAGGGGTGGG + Intronic
1167105592 19:47428484-47428506 GCGTGGCGAGTGGAAGAGCTTGG + Exonic
1167249363 19:48392248-48392270 GGTCTGAGGGAGGAAGGGCTGGG - Intergenic
1167265822 19:48482799-48482821 GGTCTGAGGGAGGAAGGGCTGGG - Intergenic
1167276626 19:48543860-48543882 GGTCTGAGGGAGGAAGGGCTGGG - Intergenic
1167276763 19:48544253-48544275 GGTCTGAGAGAGGAGGGGCTGGG - Intergenic
1167276845 19:48544475-48544497 GGTCTGAGAGAGGAGGGGCTGGG - Intergenic
1167297083 19:48657348-48657370 GAGCTGTGATTGGAAGGGCCGGG + Intergenic
1167298324 19:48664501-48664523 GGGCTGAGGGAGGAGGGGCTGGG - Intronic
1167299028 19:48668647-48668669 TGGCTGCGTGTGGCAGGGCCAGG - Intronic
1167324017 19:48813076-48813098 GGGCTTAGAGTCTAAGGGCTTGG + Exonic
1167327316 19:48834542-48834564 GGTCTGAGGGAGGAAGGGCTGGG + Intronic
1167327342 19:48834616-48834638 GGTCTGAGGGAGGAAGGGCTGGG + Intronic
1167327368 19:48834690-48834712 GGTCTGAGGGAGGAAGGGCTGGG + Intronic
1167327446 19:48834911-48834933 GGTCTGAGGGAGGAAGGGCTGGG + Intronic
1167426966 19:49434401-49434423 GGTCTGAGAGAGGAGGGGCTGGG - Intronic
1167460106 19:49620622-49620644 GGTCTGAGAGAGGAGGGGCTGGG + Intronic
1167460152 19:49620754-49620776 GGTCTGAGGGAGGAAGGGCTGGG + Intronic
1167462890 19:49635679-49635701 GAGTTTGGAGTGGAAGGGCTGGG + Intronic
1167495985 19:49818860-49818882 GGTCTGAGGGAGGAAGGGCTGGG + Intronic
1167576861 19:50321975-50321997 GGGCACCAAGGGGAAGGGCTAGG + Intronic
1167668968 19:50838916-50838938 GGTCTGAGAGAGGAGGGGCTGGG + Intergenic
1167738497 19:51311162-51311184 GGTCTGAGAGAGGAGGGGCTGGG + Intergenic
1167738525 19:51311233-51311255 GGGCTGAGGGAGGAGGGGCTGGG + Intergenic
1167798601 19:51726567-51726589 GGCCTGAGAGAGGAAGGGCTGGG - Intergenic
1168155567 19:54471985-54472007 GGTCTGAGGGAGGAAGGGCTGGG - Intronic
1168210105 19:54884060-54884082 TGGCTGCAAGTGGCAGGGGTGGG + Intronic
1168235944 19:55063177-55063199 GGGCTGCGAGGGGCGGGGCGCGG + Intronic
1168250181 19:55137475-55137497 GGGCTGAGGGAGGAGGGGCTGGG - Intronic
1168296367 19:55379006-55379028 GGGCTTAGAGTGGAGGGTCTGGG + Intergenic
1168327761 19:55546785-55546807 GGTCTGAGGGAGGAAGGGCTGGG - Intergenic
925736811 2:6970836-6970858 GGGCTGCAGGAGGAAGGACTAGG - Intronic
926217743 2:10915644-10915666 GGGCTTGGAGTGGGAGGTCTTGG + Intergenic
927135584 2:20094062-20094084 GGGCTGTGAGGGGAAAGACTGGG + Intergenic
927855884 2:26527786-26527808 GGGCTGGGCCTGGACGGGCTGGG - Intronic
927875541 2:26653040-26653062 GGGCTGCCTGTGCAAGGGGTTGG - Intergenic
928396325 2:30945602-30945624 GGACTGTGGATGGAAGGGCTAGG - Intronic
932357353 2:71077599-71077621 GGGCTCTGTGTGGAAGAGCTGGG + Exonic
932739567 2:74281368-74281390 TGACTGCAAGTGGAGGGGCTGGG - Intronic
933637049 2:84720025-84720047 GGTCTGAGAGGAGAAGGGCTAGG + Intronic
933656688 2:84894395-84894417 GGGCTGAGACTGTAAGGGCGAGG - Intronic
933840225 2:86280543-86280565 GGGTTGGGAGAGGGAGGGCTAGG + Intronic
933981122 2:87551885-87551907 GGGCTGTGAGGGGCAGAGCTGGG - Intergenic
934092960 2:88570359-88570381 GGGCAGGGACTGGAAGAGCTGGG - Intronic
935232843 2:101114324-101114346 GGGGTGCAAGGGTAAGGGCTGGG + Intronic
936312711 2:111398914-111398936 GGGCTGTGAGGGGCAGAGCTGGG + Intergenic
936988209 2:118332295-118332317 TGGCTGGGAGCTGAAGGGCTGGG - Intergenic
937073850 2:119086718-119086740 GAGCTGTCAGTGGAGGGGCTGGG + Intergenic
938063082 2:128267285-128267307 TGGCTCAGACTGGAAGGGCTGGG - Exonic
938112557 2:128578686-128578708 GGGCTGCGTGGGGATGGGCATGG + Intergenic
941696745 2:168561024-168561046 ATGCTGCTAGTGGAAGGCCTCGG + Intronic
942289548 2:174455388-174455410 TGGCTGGCAGTGGAAGGGCTTGG + Intronic
945324109 2:208463080-208463102 GGGCTGAGAGAGTTAGGGCTTGG + Intronic
946142062 2:217699907-217699929 AGGCTGAGAGTGGAAGTTCTGGG + Intronic
946306047 2:218857643-218857665 GGGAGGCGAGGGGCAGGGCTAGG + Intergenic
946352618 2:219165251-219165273 GGGCTGAGCCTGGAGGGGCTGGG - Exonic
947323747 2:228951971-228951993 GGGCTGGGAATGGAAGGGCATGG + Intronic
947588461 2:231371058-231371080 GGGCTGCGACTGGCTGGGCTGGG - Intronic
947597435 2:231421943-231421965 GGGCTGGGAGAGGAAAGGCCAGG - Intergenic
947932681 2:233976534-233976556 GGGCTGCGGGAGGAAGGGTGGGG + Intronic
948243204 2:236455937-236455959 GGGCTGCCAGTGGTGGGGGTGGG - Intronic
948396377 2:237648208-237648230 TGGCTGCTAGGGGAAGGGCTAGG - Intronic
948587391 2:239027935-239027957 GGGCAGTGAGGGGAAGGGCTTGG - Intergenic
948908755 2:240992601-240992623 GGGCTCTGAGGGGAAGAGCTTGG + Intronic
1169664978 20:8023232-8023254 GGGCTACAAATGGAAGGGGTGGG + Intergenic
1170799942 20:19582813-19582835 GCGCAGCGAGTGGAAGGGCCTGG + Intronic
1170987095 20:21268479-21268501 GGGCTGCCAGTGGGACAGCTGGG - Intergenic
1171173171 20:23033615-23033637 GGGCTTAGTGTGGAAGTGCTGGG - Intergenic
1171235514 20:23521127-23521149 GGGCGGGGAGTGAAAGGGCAAGG - Intergenic
1172068910 20:32241984-32242006 AGCCTGTGAGTGGAAGAGCTGGG + Intergenic
1172133806 20:32673832-32673854 AGGCTGCAGCTGGAAGGGCTGGG + Intergenic
1172526417 20:35602590-35602612 GGTCTGCGAATGGAAAGCCTTGG + Intergenic
1173010297 20:39175999-39176021 GGGCTGCCAGTGGAAATGCGGGG + Intergenic
1173228078 20:41173682-41173704 GATCTGGAAGTGGAAGGGCTTGG - Exonic
1173439063 20:43059061-43059083 AGGCTCAGAGTGCAAGGGCTAGG - Intronic
1173464917 20:43273101-43273123 GGGCTGGGAGTCAAAGGGTTTGG - Intergenic
1173822181 20:46026534-46026556 GGGGTGTCAGTGGAGGGGCTGGG + Intronic
1174321864 20:49748242-49748264 GGGCTGCGAGTTGAAGGCCAGGG + Intergenic
1175140999 20:56860177-56860199 GGGCTGAGAGGGGAGGGGCTGGG - Intergenic
1175511195 20:59527472-59527494 GTGCTGGGAATGGAAGGGCATGG + Intergenic
1175992281 20:62795643-62795665 GTGCTGCGAGGGTCAGGGCTCGG - Intergenic
1176045107 20:63088497-63088519 GTCCTGAGAGTGGAAGGGGTGGG + Intergenic
1176106871 20:63393568-63393590 GGGCGGGGAGTGCCAGGGCTGGG + Intergenic
1176690698 21:9904746-9904768 GGGCAGAGATTGGAAGGGTTTGG - Intergenic
1176952692 21:15065078-15065100 GGGCGGCGAGGGGAGGGACTGGG - Intergenic
1179545145 21:42108609-42108631 GAGCTGCGGGTGGAGGTGCTCGG - Intronic
1181967006 22:26663876-26663898 GGGCTGAGAGGGGATTGGCTGGG - Intergenic
1183903487 22:41022682-41022704 GGGCTGCACGTGCAAGGCCTCGG + Intergenic
1183949264 22:41343615-41343637 CGGCTGGGGGTGGAGGGGCTGGG - Intronic
1184100320 22:42338513-42338535 GGGCTGCGAGTGGAAGGGCTGGG + Intronic
1184298872 22:43543345-43543367 GAGGTGCGAGGAGAAGGGCTGGG - Intronic
1184523185 22:45007675-45007697 GGGCTGCGCGGGGAAGGGGCGGG + Intronic
1184977655 22:48074385-48074407 GGGCAGCGAGTGGAAGGGACAGG + Intergenic
1185058735 22:48594472-48594494 GGGCTGGGATAGGGAGGGCTGGG + Intronic
949918645 3:8984695-8984717 GGCCTCCGGGTGGAAGGGCAGGG + Exonic
950260975 3:11543321-11543343 GGGCTGGGGTTGGAAAGGCTGGG + Intronic
950457549 3:13101637-13101659 GGGCTGCAGGCGGAAGGGCTGGG + Intergenic
950520351 3:13494548-13494570 GGGGTGGGAGTGTAAGAGCTGGG - Intronic
951587458 3:24230018-24230040 ATGCTGTGAGTGGAAGTGCTGGG + Intronic
953568906 3:44056477-44056499 GGGCTGGGAGTGGAAGCCCAGGG - Intergenic
954224587 3:49173767-49173789 GGGCTGGGAGAGGAATGGCTTGG - Intronic
954300310 3:49697659-49697681 GGGCTGTGCTGGGAAGGGCTGGG - Intronic
954847443 3:53572203-53572225 GGGCTGGGAGTGGCCAGGCTTGG - Intronic
955338278 3:58104928-58104950 GGCCTGCAGGAGGAAGGGCTTGG + Intronic
955502145 3:59595977-59595999 AAGCTGCCAGGGGAAGGGCTAGG + Intergenic
956745457 3:72307421-72307443 GGGCTGAGAGAGGAAGAGCAGGG + Intergenic
958985483 3:100775784-100775806 GAGCTGAGAGTGGAAGGGCAAGG + Intronic
959910949 3:111763047-111763069 GGGCTGCCTGTAGAAGTGCTGGG - Intronic
960137938 3:114124406-114124428 GGGGTGCAAGTGGATGGGGTAGG + Intergenic
960978654 3:123201657-123201679 GGGCGGCGAGCGGAAGAGATTGG + Intronic
961305869 3:125958931-125958953 GGGCTGCCAGGAGTAGGGCTGGG - Intergenic
961507553 3:127380547-127380569 GGCCTAGGAGTGGAAGTGCTTGG - Intergenic
966675862 3:182589168-182589190 TACCTGGGAGTGGAAGGGCTGGG - Intergenic
966735423 3:183182969-183182991 GGGCTGGGACTGGAAGGCCTGGG - Intronic
967950430 3:194836217-194836239 GGGCTGTGAGTTGGAGGGCAGGG - Intergenic
968032403 3:195511631-195511653 GGGCTGGGGAAGGAAGGGCTGGG - Intergenic
968803230 4:2756409-2756431 GGGCTGCGTGGGGGAGGGCGGGG - Intergenic
968803247 4:2756446-2756468 GGGCTGCGCGGGGAAGGGCGGGG - Intergenic
969138339 4:5049143-5049165 GCGCTGAGACTGGAAGGGCAAGG - Intergenic
970213525 4:13734978-13735000 GTGCTGTGATTGGAAGGGGTGGG + Intergenic
971571137 4:28212494-28212516 GGGCTGTGGGTGGAAGGGTTGGG - Intergenic
973555369 4:52076798-52076820 CGGCTGCGAGGGGCAGGGCTGGG - Exonic
976215612 4:82712767-82712789 GGGCTGCCAGTGACAGGGCAAGG + Intronic
976316564 4:83664877-83664899 GGTCTTCCAGTGGAAGGGCAAGG - Intergenic
978042617 4:104088135-104088157 GGGCTGGGAGTGGCAGGGAATGG - Intergenic
978763240 4:112378052-112378074 GGGCTGCGGGCGGACGGGCAGGG + Intronic
979669877 4:123350948-123350970 TGGCAGCAAGTGGCAGGGCTGGG + Intergenic
980517022 4:133877305-133877327 GAGCTCCCAGTGGAAGGGGTGGG - Intergenic
987340664 5:16936346-16936368 GGGCCGCGAGCGGGAGGGCGGGG - Intergenic
991666900 5:69008355-69008377 GGGGTGGGAGTGGAAGGGAGGGG - Intergenic
994158247 5:96526936-96526958 GGGGTGGGAGTGGCAGGGGTAGG + Intronic
998266450 5:140671072-140671094 GGGCTGGGAGCGGGAGGGCAAGG + Exonic
998529549 5:142872058-142872080 TGGCTGCTAGTGGAAGAGCTGGG - Intronic
1002174323 5:177393068-177393090 GGGCTGTGTGTGGAAGAGGTGGG - Intronic
1002904500 6:1437959-1437981 GGGCTGCCAGTGTCAGAGCTCGG + Intergenic
1003175963 6:3752174-3752196 GGGCTGCGAGTGTCGGGGCGGGG + Intergenic
1004231099 6:13834057-13834079 GGGCTTGGCGTGGAAGAGCTTGG + Intergenic
1006339884 6:33440991-33441013 GGGCAGGGAGTGGCAGGGCAGGG + Intronic
1006339889 6:33441006-33441028 GGGCAGGGAGTGGCAGGGCTGGG + Intronic
1007047885 6:38796205-38796227 GGGCTGGCTCTGGAAGGGCTGGG - Intronic
1007135014 6:39512429-39512451 GGGCTGCAGGTGGGAGGCCTTGG - Intronic
1007417954 6:41703005-41703027 AGGCTGGGAGGGGAAGGGCCAGG + Intronic
1007673391 6:43575612-43575634 GGGCCGCGAGGGGAAGGTCCCGG + Intronic
1010019078 6:71139059-71139081 GAGCTCCCAGTGGAAGGGATGGG + Intergenic
1011558933 6:88595828-88595850 GGGCTGTGAAAGGAGGGGCTGGG + Intergenic
1012215282 6:96575416-96575438 AGGCTGGGAAGGGAAGGGCTTGG - Intronic
1015343796 6:132131996-132132018 GGGGTGGGAGTGGGAGGGGTTGG - Intergenic
1015968720 6:138721888-138721910 GGGCAGGGAGTGGTAGAGCTTGG - Intergenic
1015999573 6:139029224-139029246 GAGCTGGGTGGGGAAGGGCTGGG + Intronic
1017300019 6:152846185-152846207 AGGCTGGGAGTGGAAGGCATGGG + Intergenic
1017542658 6:155418570-155418592 GGGCGGGGAGTGGAAGGGGAGGG - Intronic
1017787048 6:157765177-157765199 CAGATCCGAGTGGAAGGGCTCGG - Intronic
1019031629 6:169018586-169018608 GGGCTACCAGTGGCAGGGGTGGG + Intergenic
1019373470 7:676275-676297 GGGCTGAGCGTGAAGGGGCTTGG - Intronic
1022487472 7:30790915-30790937 GGGCTGCGAGAGAAAGGCCCAGG + Intronic
1023535429 7:41203659-41203681 GGGGTGGGAATGGAAGGGCCAGG - Intergenic
1024221928 7:47295703-47295725 GGTGTGAGAGTGGAAGGGGTGGG - Intronic
1026368080 7:69670100-69670122 AGTCTGGGGGTGGAAGGGCTGGG - Intronic
1027267852 7:76503957-76503979 GGGTTGGGAGTGGCAGGGCCAGG + Intronic
1027273385 7:76536572-76536594 GAGCTGAGAGTAGAGGGGCTAGG + Intergenic
1027319663 7:77003819-77003841 GGGTTGGGAGTGGCAGGGCCAGG + Intergenic
1028877762 7:95842576-95842598 GGGCTGCCAGTGAAAGAGCCAGG + Intronic
1029192779 7:98783576-98783598 GGGCTGGGAGAGGAAGGAGTGGG + Intergenic
1029807154 7:103009787-103009809 GGGCTGCAAGTGGCAGAGTTGGG - Intronic
1034255467 7:149722481-149722503 GGGCTATGGGTGGGAGGGCTGGG - Exonic
1034397521 7:150838562-150838584 GGGCTGGGAGGGGCTGGGCTTGG - Intronic
1034570893 7:151955557-151955579 GGTCTGTGAGTGGAAGGGGGTGG - Intergenic
1034869016 7:154666648-154666670 AGGCTGGGAGTGGGAGGGATTGG - Intronic
1035411370 7:158645380-158645402 AGGCAGGGAGTGGAAAGGCTGGG + Intronic
1038764563 8:30415179-30415201 GGGAGGGGAGGGGAAGGGCTGGG - Intronic
1043794282 8:84516039-84516061 GGGCTGAGAGTGGGAGAGGTGGG + Intronic
1044698908 8:94949172-94949194 GGGCTGCGCGGGGAAGGGAGCGG + Exonic
1044752725 8:95431536-95431558 CGGCTGAGACAGGAAGGGCTTGG - Intergenic
1044822129 8:96161547-96161569 GGACTGCGAGAGGAGAGGCTGGG - Intergenic
1045511814 8:102817425-102817447 GGGCTGGGAGTGGACGTGCAGGG + Intergenic
1046671840 8:117064771-117064793 GGGCTGGGTGAGGAGGGGCTGGG - Intronic
1048209524 8:132443246-132443268 GTGCTGGGGGTGGAAGGGATGGG - Intronic
1049242637 8:141546058-141546080 GGCCTGGGAGTGGAATTGCTGGG + Intergenic
1049423781 8:142528328-142528350 GGGCTGCAAGTGGCAGGCATGGG - Intronic
1049525759 8:143126109-143126131 ATGCTGCGGGTGGAAGGGCATGG + Intergenic
1049990083 9:982144-982166 GGGCTGGGTGAGGAAGGCCTAGG - Intronic
1053142614 9:35690764-35690786 GGGCGGGGAGCGGAGGGGCTCGG - Exonic
1053627429 9:39889260-39889282 GGGCAGAGATTGGAAGGGTTTGG - Intergenic
1053778562 9:41576761-41576783 GGGCAGAGATTGGAAGGGTTTGG + Intergenic
1054166524 9:61787005-61787027 GGGCAGAGATTGGAAGGGTTTGG + Intergenic
1054216458 9:62361443-62361465 GGGCAGAGATTGGAAGGGTTTGG + Intergenic
1054671024 9:67793900-67793922 GGGCAGAGATTGGAAGGGTTTGG - Intergenic
1056822746 9:89854916-89854938 GGGCTGTAAGAGGTAGGGCTGGG + Intergenic
1057787298 9:98096606-98096628 GGCCTGAGAGATGAAGGGCTGGG - Intronic
1059199753 9:112403246-112403268 GAGCTGGGAGTGGGAGGGATTGG - Intronic
1060192025 9:121599483-121599505 GGCCTGCGATTGGCAGGGCTGGG + Intronic
1060192251 9:121600301-121600323 GGGAGGCGATTGGCAGGGCTGGG + Intronic
1060242311 9:121914639-121914661 GGGCTGCGTGAGGATGTGCTGGG - Intronic
1060700894 9:125747902-125747924 GGGCTGCGAGGGGCAGGACGGGG - Intronic
1060972913 9:127748987-127749009 GGCCAGCGAGTGGCAGAGCTGGG + Intronic
1060995564 9:127873477-127873499 GGCCTGAGAGGGGAAGGGCAGGG - Intronic
1061040218 9:128137368-128137390 GGGCTGTAAGAGGTAGGGCTGGG - Intergenic
1061164340 9:128913655-128913677 GGACAGCGAGTGGCAGAGCTCGG - Intronic
1061488109 9:130930546-130930568 GGGCAGCGAGAGGGAAGGCTTGG - Intronic
1061630284 9:131867908-131867930 GGGCTTTGAGTGGCAAGGCTGGG + Intronic
1061679492 9:132235996-132236018 GGAGTGCTGGTGGAAGGGCTTGG - Intronic
1061840533 9:133356404-133356426 GGGCTGCGGGCGGCGGGGCTGGG - Exonic
1061967628 9:134025232-134025254 GAGCTGGGAGAGGAGGGGCTGGG - Intergenic
1062219892 9:135409496-135409518 GGACTGCGGGTGGAACGGGTGGG + Intergenic
1062290386 9:135791741-135791763 GAGCTGGGAGGGGCAGGGCTGGG + Intronic
1062413552 9:136436652-136436674 GGGCCGCGTGTGCACGGGCTGGG - Intronic
1062538356 9:137030667-137030689 TGGGTGTGGGTGGAAGGGCTGGG - Exonic
1062582055 9:137233118-137233140 GAGTTGTGGGTGGAAGGGCTGGG + Intronic
1186808389 X:13162678-13162700 GGGGTGCTAGTGGGAGGGATAGG + Intergenic
1189381535 X:40505952-40505974 GGGTTGGGAGTGGAAGATCTGGG + Intergenic
1190726353 X:53193100-53193122 GGGCTGCCAGTGGTGGGGATGGG + Exonic
1198750457 X:139932655-139932677 GGGCTGCGAGCGAAACGGCGCGG - Intronic
1199601944 X:149546301-149546323 GTGCTGTGAGTGGTGGGGCTGGG - Intronic
1199648442 X:149933183-149933205 GTGCTGTGAGTGGTGGGGCTGGG + Intronic
1199869893 X:151888842-151888864 GGGCTGTGAGTGGAATGGTATGG + Intergenic
1200017690 X:153179152-153179174 GGGGTGAGGGTGGAATGGCTGGG - Intergenic
1200054936 X:153455394-153455416 GGGCTGGGAGGGGCTGGGCTGGG - Intronic
1200323828 X:155216827-155216849 GGGCGGCGGGTGGCAGGGCAGGG + Intronic