ID: 1184100321

View in Genome Browser
Species Human (GRCh38)
Location 22:42338529-42338551
Sequence GGCTGGGAAAATAATTACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100314_1184100321 11 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1184100321 22:42338529-42338551 GGCTGGGAAAATAATTACCGAGG No data
1184100310_1184100321 16 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100321 22:42338529-42338551 GGCTGGGAAAATAATTACCGAGG No data
1184100309_1184100321 24 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1184100321 22:42338529-42338551 GGCTGGGAAAATAATTACCGAGG No data
1184100315_1184100321 10 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100321 22:42338529-42338551 GGCTGGGAAAATAATTACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100321 Original CRISPR GGCTGGGAAAATAATTACCG AGG Intronic
No off target data available for this crispr