ID: 1184100322

View in Genome Browser
Species Human (GRCh38)
Location 22:42338532-42338554
Sequence TGGGAAAATAATTACCGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100310_1184100322 19 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100322 22:42338532-42338554 TGGGAAAATAATTACCGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 120
1184100309_1184100322 27 Left 1184100309 22:42338482-42338504 CCACTCGGCCAATCCCGAAGAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1184100322 22:42338532-42338554 TGGGAAAATAATTACCGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 120
1184100315_1184100322 13 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100322 22:42338532-42338554 TGGGAAAATAATTACCGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 120
1184100314_1184100322 14 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1184100322 22:42338532-42338554 TGGGAAAATAATTACCGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100322 Original CRISPR TGGGAAAATAATTACCGAGG AGG Intronic
901322105 1:8346167-8346189 TGGGAAAATCATAACCAAGGTGG - Intergenic
906044799 1:42820080-42820102 AGGGAAAATAATTTCCAATGTGG - Intronic
906174930 1:43762851-43762873 TGGGGAAATGATAACCAAGGAGG + Intronic
907963344 1:59304781-59304803 TAGGAAAAAATTTACCAAGGAGG - Intronic
908479583 1:64525073-64525095 TGGGAAAATATTCACAGAGATGG - Intronic
909392235 1:75131537-75131559 TTTGATAAGAATTACCGAGGCGG + Intronic
912253171 1:108031885-108031907 TGGGAAATTAATTACCCAGAAGG + Intergenic
915125968 1:153664960-153664982 TGAGAAAATATTTATGGAGGGGG - Intronic
916679638 1:167092644-167092666 GGGGAAGGGAATTACCGAGGGGG - Intergenic
917476929 1:175376940-175376962 TGGGAAAATTATTATTGAGTAGG - Intronic
919642682 1:200060700-200060722 TGTGAAAATTATTTCCAAGGAGG - Intronic
923049811 1:230383003-230383025 AGGGAAAATAAATAGCGAGATGG - Intronic
924276074 1:242388549-242388571 TGGGCTAAGAATTACTGAGGCGG + Intronic
924406558 1:243754042-243754064 TGGGAAAATAAATAGAGATGAGG - Intronic
924424530 1:243939201-243939223 TGTGAAAATAATAATGGAGGGGG - Intergenic
1065885512 10:30073557-30073579 TGGGAAAAATATTACAGAGATGG + Intronic
1068541992 10:58305110-58305132 TTGGAAAATAATTACAAAGATGG - Intergenic
1068572308 10:58643667-58643689 TTGGAAAATAATTTGAGAGGAGG + Intronic
1077715878 11:4580056-4580078 TGGGCAAATAATGACAAAGGAGG + Intergenic
1079875443 11:25850784-25850806 TGGGAAAACAATTAACAAAGTGG + Intergenic
1080504578 11:32899972-32899994 GGTGATAATAATTACTGAGGTGG - Intronic
1081448077 11:43149110-43149132 TAGGAAAAATATCACCGAGGGGG + Intergenic
1086498085 11:87424639-87424661 TGGGAAAATAATCACTTCGGTGG - Intergenic
1097974009 12:65665285-65665307 AGGGAACATAAATACAGAGGAGG - Intergenic
1100138059 12:91579394-91579416 TGAGAAAATAAGCACTGAGGGGG - Intergenic
1103625594 12:122216800-122216822 TGGGAAAATGAATTCAGAGGAGG - Exonic
1104446893 12:128841906-128841928 TGTAGAAATAATTACCGAGGAGG - Intergenic
1111016659 13:82390031-82390053 TGGGAAATTGATAACTGAGGAGG - Intergenic
1113157313 13:107338562-107338584 TGGGAAAACAATTATTCAGGGGG - Intronic
1115091101 14:29576766-29576788 TGGGAAAAAAATGAATGAGGAGG - Exonic
1115694963 14:35887101-35887123 TGGAAAAATAGTTATCCAGGTGG + Intronic
1117777447 14:59197205-59197227 TGAAAAAATAATTCCCGCGGTGG - Intronic
1119204575 14:72784513-72784535 TGGGAAAATAAGTATAGTGGGGG - Intronic
1119234595 14:73008951-73008973 TGGGAAAATGTTAACAGAGGTGG - Intronic
1120025705 14:79581653-79581675 GGGGAAAATAATTACCAACTGGG - Intronic
1121387937 14:93546365-93546387 TGAGAAAATAATGACAGTGGAGG - Intronic
1125395836 15:39246656-39246678 TGGGAAAGTAATAATAGAGGTGG + Intergenic
1125542079 15:40475412-40475434 TGGAAAAATAATGACCCAGAAGG - Intergenic
1126851699 15:52801188-52801210 TGGAAAAATAACTACCAAGCCGG + Intergenic
1128317344 15:66669536-66669558 TGGGGAAATAAGTGCAGAGGCGG + Intronic
1130746075 15:86655172-86655194 TGGGAAAATTATTAGCAAGGAGG + Intronic
1131839386 15:96419292-96419314 TGGGAAAGACATTACCAAGGTGG + Intergenic
1135032938 16:19053276-19053298 TGAAAAAATAATTACCAAGCAGG - Intronic
1135357345 16:21780518-21780540 TGGCAAAACAATTTCGGAGGCGG - Intergenic
1135455849 16:22596634-22596656 TGGCAAAACAATTTCGGAGGCGG - Intergenic
1135586840 16:23678316-23678338 TGGGAAATTCAGTAGCGAGGAGG + Intronic
1138567689 16:57845563-57845585 TGGGGAAAGAATGTCCGAGGTGG - Intronic
1138750501 16:59414138-59414160 AGGGGAAATAATTACAGATGTGG - Intergenic
1139521941 16:67488141-67488163 TGGGAAATTATTGACTGAGGGGG + Intergenic
1139796834 16:69489822-69489844 TAGGAAAATATTTACCAATGTGG + Intergenic
1140699790 16:77571131-77571153 TGGGAAAATATATACCGATCTGG - Intergenic
1141256278 16:82405348-82405370 GAGGAAAATAATTACCGGGAGGG + Intergenic
1143753303 17:9047571-9047593 GGGGGAAATAATTACAGATGTGG - Intronic
1144307949 17:13986386-13986408 ATGGAAAATAAATAACGAGGTGG - Intergenic
1150976109 17:70088761-70088783 TAGGAAAAAAATTAAGGAGGTGG + Intronic
1153261586 18:3229496-3229518 TGGGCAAATACTTCCCAAGGAGG - Intergenic
1154952702 18:21225815-21225837 TGAGAAAGTAATTACAGATGTGG - Intergenic
1158299854 18:56039205-56039227 TGAGAAAATATTTTCTGAGGAGG + Intergenic
1161405100 19:4087092-4087114 TGGAAAAAAAAATACCGAGCTGG + Intergenic
1161954737 19:7487205-7487227 TGGGAAAAGAAGGACCTAGGAGG - Intronic
926411554 2:12608422-12608444 TGGGATGATAATTACCAGGGAGG - Intergenic
927577166 2:24209408-24209430 TGGAAAAGTCATTATCGAGGTGG + Intronic
928487197 2:31744794-31744816 TGAGAAAATAATTGCTGAGTGGG + Intergenic
929698442 2:44140607-44140629 TGGGAAAGTAATAAGGGAGGAGG + Intergenic
933906526 2:86899268-86899290 TGGGAAAAGAATGACCGACCAGG - Intergenic
934024948 2:87994378-87994400 TGGGAAAAGAATGACCGACCAGG + Intergenic
935226442 2:101057015-101057037 TTGAAAAATAATTCCTGAGGAGG - Intronic
935492155 2:103734247-103734269 TGAGAAAATAATAACTGAGAAGG - Intergenic
937968218 2:127530715-127530737 TGGGAAAAGAAGTACTGGGGTGG - Intergenic
942582448 2:177433192-177433214 TGAGAAAACAATAACCCAGGAGG + Intronic
943174305 2:184450059-184450081 GGGGAAAATAATTATTGAGGTGG - Intergenic
944408424 2:199412209-199412231 TTGGAAAATATTTAACAAGGAGG + Intronic
946227374 2:218271201-218271223 TGGGAAAATCGCCACCGAGGTGG - Intronic
1169692201 20:8344489-8344511 TGGGAAAATAATAAAGGATGTGG - Intronic
1172384063 20:34520859-34520881 TAGGAAAATAATTTCTGAGGTGG + Intronic
1181435190 22:22906357-22906379 TGGGAACAGAGTGACCGAGGGGG - Intergenic
1181438240 22:22922609-22922631 TGGGAACAGAGTGACCGAGGGGG - Intergenic
1183293385 22:37016426-37016448 TGTGAACACAATTACAGAGGAGG + Intronic
1183492189 22:38122613-38122635 TGGGAAATTAAGTTCCCAGGTGG - Intronic
1183812266 22:40266958-40266980 TGGGATAAGAATTCCCAAGGGGG + Exonic
1184100322 22:42338532-42338554 TGGGAAAATAATTACCGAGGAGG + Intronic
949168601 3:971047-971069 AGGGAAAATAAATAAAGAGGAGG - Intergenic
949304672 3:2626588-2626610 AGGGAAAATAATTACCCAAGAGG + Intronic
949682538 3:6531304-6531326 CAGGAAAATCATTACAGAGGAGG + Intergenic
953564508 3:44019911-44019933 TGGGTAAATAATTAGAGAGCTGG + Intergenic
954765221 3:52909691-52909713 TGGGAGAATCACTACAGAGGAGG - Intronic
959580279 3:107976410-107976432 AGGAAAAATAAATACGGAGGTGG - Intergenic
963806052 3:149724096-149724118 TGGTAAAATTATTATCTAGGTGG + Intronic
965105723 3:164349498-164349520 TAAGAAAATAATTACAGAGGTGG + Intergenic
965881504 3:173393988-173394010 TGGGAAAAAAATGAGCAAGGAGG + Intergenic
967347169 3:188470445-188470467 TGGGAAAATATTTCCTGAGTGGG - Intronic
969196564 4:5567893-5567915 TGGGATAAGAATTACATAGGGGG + Intronic
977536743 4:98262089-98262111 TTGGAAAATAATTTCCGTGCAGG - Intronic
979179098 4:117702877-117702899 TAGGAAAATAATGACCCTGGAGG + Intergenic
981712560 4:147723657-147723679 TGGGAAAATGATTACCCCGGTGG + Intergenic
982255928 4:153451809-153451831 AGGGAAAATAATTTCAAAGGAGG + Intergenic
990643346 5:57814391-57814413 TGATAAAATAATTACCTGGGAGG - Intergenic
992923940 5:81560542-81560564 TGGGAAAATAAGCACTGAGGTGG - Intronic
993485024 5:88473304-88473326 TGGAAAAATAATTTAAGAGGGGG + Intergenic
994517809 5:100793468-100793490 TGGGAAAAAAAATACCTAGATGG - Intergenic
994556366 5:101311087-101311109 TGGGAAACTAATTAGGAAGGAGG - Intergenic
995656797 5:114434918-114434940 TGGTAAAATAATTTCCTATGAGG + Intronic
995975392 5:118029493-118029515 TGTGAAAAGAATTACTGAAGAGG + Intergenic
1004141635 6:13023442-13023464 TTGCAAAATAATTACCGTGGAGG - Intronic
1005577934 6:27207529-27207551 TGGGAAAATAACTACAGAGTAGG - Intergenic
1006310124 6:33251463-33251485 GGGGAAAATAATTAATGATGGGG + Intronic
1008437198 6:51490194-51490216 TTGGAAAATAAGTACTGAGCTGG - Intergenic
1009604106 6:65844866-65844888 TGGAAAAATCAATACCTAGGAGG - Intergenic
1010577807 6:77554266-77554288 TGGGATCATAATTACTGATGTGG - Intergenic
1013468279 6:110436813-110436835 AGGGAGAATAAAAACCGAGGTGG - Intronic
1015253720 6:131154282-131154304 TGGGAAAAAAATAACCTAGACGG + Intronic
1015688591 6:135894807-135894829 TGGGAACATGTTTACCCAGGTGG + Intronic
1017126637 6:151070840-151070862 TGGGAAAATAGTTCCCAATGAGG - Intronic
1022990115 7:35698468-35698490 AGGAAAAATAATTACCAATGAGG + Intergenic
1027243568 7:76350011-76350033 TTGGTAAATAATCCCCGAGGAGG + Intronic
1030522545 7:110616303-110616325 TGGGAATAAATTTACCAAGGAGG - Intergenic
1034230706 7:149525845-149525867 TGGTAAAATTACTACAGAGGTGG + Intergenic
1035442296 7:158911658-158911680 TGGGAAAAAAAATACCAAGCAGG + Exonic
1035942633 8:3919845-3919867 TGGGGAAAAAATAACCAAGGAGG - Intronic
1039158668 8:34592227-34592249 TAGGAAAACATTAACCGAGGAGG - Intergenic
1043751286 8:83938813-83938835 TGGGAAAATAATTAAATAAGTGG - Intergenic
1047367290 8:124223115-124223137 AGGGAAAATAATTACCTATCGGG - Intergenic
1050033944 9:1415242-1415264 TGGGTAAATATTTACAGAGCTGG + Intergenic
1050067547 9:1776394-1776416 TGGGAAAATAGCTACAGAGTCGG + Intergenic
1050876446 9:10643743-10643765 TGGGTAAATGATTACTAAGGTGG - Intergenic
1056222262 9:84461852-84461874 TGGTACAATAATGACAGAGGCGG - Intergenic
1058006461 9:99920968-99920990 TGAGAAAATAATAACAGTGGAGG + Intronic
1059058366 9:111008353-111008375 TGGGTAAACATTTACAGAGGTGG - Intronic
1059067266 9:111098632-111098654 TGGGGTAACAATTACTGAGGAGG - Intergenic
1059817058 9:117928522-117928544 TGGCAAAATAATTGCTGATGTGG + Intergenic
1189079209 X:37951989-37952011 TGGCAAAAGAAATACAGAGGGGG + Intronic
1189533639 X:41913014-41913036 TGGGGAAATCATTACAGAGGAGG - Intronic
1190617570 X:52251438-52251460 TGGGGAAGTAATTACTGAAGAGG - Intergenic
1193203272 X:78717376-78717398 TGGCAAGATAATTACAGTGGAGG + Intergenic
1200280943 X:154776372-154776394 TGGGGAAAGAATTACCCAGGTGG + Intronic