ID: 1184100323

View in Genome Browser
Species Human (GRCh38)
Location 22:42338537-42338559
Sequence AAATAATTACCGAGGAGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100310_1184100323 24 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100323 22:42338537-42338559 AAATAATTACCGAGGAGGCCCGG 0: 1
1: 0
2: 0
3: 21
4: 206
1184100314_1184100323 19 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1184100323 22:42338537-42338559 AAATAATTACCGAGGAGGCCCGG 0: 1
1: 0
2: 0
3: 21
4: 206
1184100315_1184100323 18 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100323 22:42338537-42338559 AAATAATTACCGAGGAGGCCCGG 0: 1
1: 0
2: 0
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100323 Original CRISPR AAATAATTACCGAGGAGGCC CGG Intronic
901053016 1:6435112-6435134 AAAAGATTCCCGAGTAGGCCTGG - Intronic
902183902 1:14710885-14710907 AAATAATTATTGAGGGGGGCTGG + Intronic
903189222 1:21647309-21647331 AAATAATTACCCAGGAGTGATGG + Intronic
903520500 1:23943996-23944018 AAAAAATTAGCCAGGCGGCCGGG - Intergenic
904170112 1:28585786-28585808 AAATAATCACCAAGTGGGCCGGG + Intergenic
904518994 1:31079484-31079506 AGATAATTGTAGAGGAGGCCGGG + Intergenic
906341267 1:44983063-44983085 AAAGAATTAGCCAGGCGGCCAGG - Intronic
907048495 1:51314376-51314398 AAATAATTCACGAGGAGACCTGG - Intronic
910994146 1:93086206-93086228 AAATAATGAAGGAGGAGGCCGGG + Intronic
911076787 1:93883537-93883559 AAAGAATTACTAAGGAGGCTAGG + Intergenic
913330760 1:117665443-117665465 AAAAAATTACTGAACAGGCCGGG - Intergenic
914457879 1:147853665-147853687 AAATCATTCCTGAGGAGCCCTGG - Intergenic
914789332 1:150863066-150863088 AAAAGATTACCATGGAGGCCAGG + Intronic
914864357 1:151413925-151413947 AAATAATTTCAGAGAAAGCCTGG - Intronic
915124983 1:153657599-153657621 AAAAAATTAGCCAGGCGGCCAGG - Intergenic
915132239 1:153703592-153703614 AAAAAATCACCTAAGAGGCCAGG + Intergenic
916547255 1:165817467-165817489 AAAAAATTAGCCAGGCGGCCGGG + Intronic
920538025 1:206753133-206753155 AAATTGTTTCCTAGGAGGCCGGG - Intergenic
921232658 1:213088656-213088678 AAAAAATTAGCCATGAGGCCAGG - Intronic
922794221 1:228331934-228331956 AATTTATTACAGAAGAGGCCGGG + Intronic
922822187 1:228492343-228492365 AAACAATAACAGAAGAGGCCTGG - Intronic
923193190 1:231640513-231640535 AAAAAAATACCAAGGAGGTCTGG - Intronic
923341982 1:233015401-233015423 AAAAAATTAGCCAGGTGGCCGGG + Intronic
923406834 1:233669550-233669572 AAATAATTATAAAGGAGGCTGGG + Intronic
923653572 1:235896488-235896510 CAAGAATTACAGAAGAGGCCGGG + Intergenic
1063042888 10:2360762-2360784 AAATAATGAAAGAGGGGGCCGGG + Intergenic
1063761350 10:9081789-9081811 AAATAAATACCTATGAGACCTGG + Intergenic
1066435072 10:35390279-35390301 AAATAGTTGCCCAGGATGCCTGG + Intronic
1066470617 10:35694169-35694191 GAAAAATTACTGAGGAGGCTTGG - Intergenic
1069946978 10:71993802-71993824 TAAAAATTAGCCAGGAGGCCGGG + Intronic
1071727639 10:88215991-88216013 CAAAAATTACAGATGAGGCCGGG - Intergenic
1072457819 10:95592139-95592161 AAAAAATTACCTGGGTGGCCGGG - Intergenic
1072833850 10:98690243-98690265 AAATAACTACAGAGAAGGCCGGG + Intronic
1078249887 11:9608222-9608244 AAAAAATTAGCCAGGCGGCCGGG - Intergenic
1078717304 11:13852366-13852388 AAGTGATCACCAAGGAGGCCAGG - Intergenic
1080516855 11:33030877-33030899 AAATAATTACACATCAGGCCTGG - Intronic
1084105920 11:66980350-66980372 AAAAAATTAGCCAGGTGGCCAGG - Intergenic
1084785951 11:71441767-71441789 CAACAATTACAGAGGGGGCCAGG - Intronic
1085505614 11:77056915-77056937 AAATTAGCACCGAGGAGGCAGGG - Intergenic
1085876796 11:80417259-80417281 AAAGAATTACAGAGGAGTCTAGG - Intergenic
1088273108 11:108055924-108055946 AAAAAATTAGCCAGGTGGCCGGG - Intronic
1089244059 11:117105482-117105504 AAAAAATTAGCCAGGAGGCTGGG + Intergenic
1090026304 11:123170319-123170341 AAATTACTACCTAAGAGGCCTGG - Intronic
1092347581 12:7728639-7728661 AAAAAATTAGCCAGGTGGCCGGG - Intergenic
1093037388 12:14345526-14345548 GAATAAATACAAAGGAGGCCGGG - Intergenic
1093725459 12:22503414-22503436 AAATAATTACTTAAGAGGCCTGG + Intronic
1094820990 12:34224395-34224417 AAATAATAACAGCTGAGGCCAGG - Intergenic
1096725710 12:53560215-53560237 AAAAAAGTAAAGAGGAGGCCGGG - Intronic
1100601567 12:96116028-96116050 AATTAATTTCCGAGGAGCCCTGG + Intergenic
1102478841 12:113206762-113206784 AAAAAATCACTGGGGAGGCCGGG + Intronic
1103135464 12:118503276-118503298 AAAAAATTAGCCAGGAGGCCAGG - Intergenic
1103256767 12:119548310-119548332 AAACAAACACAGAGGAGGCCGGG + Intergenic
1103816441 12:123661345-123661367 AAATGTTTACTGACGAGGCCGGG + Exonic
1110697641 13:78510420-78510442 AAATACTTACAGACGAGGCCGGG - Intergenic
1112390975 13:98983910-98983932 AAAAAATAATTGAGGAGGCCGGG - Intronic
1114823949 14:26054325-26054347 GACAAATTACCAAGGAGGCCAGG + Intergenic
1117356433 14:54928243-54928265 TCATAATCACCCAGGAGGCCTGG + Intergenic
1117374326 14:55107174-55107196 ATAAAAATACCAAGGAGGCCGGG - Intergenic
1118405870 14:65422951-65422973 AGAAAATCACTGAGGAGGCCAGG - Intronic
1118881708 14:69832578-69832600 AAATAATTACCTATGAGGGATGG - Intergenic
1119394949 14:74319330-74319352 AAATACATCCCGAGGGGGCCAGG - Intronic
1124271431 15:28284625-28284647 AGATAATTACCAGGAAGGCCGGG + Intronic
1124454955 15:29833687-29833709 AAATACTTTCCAAGTAGGCCGGG - Intronic
1124819157 15:33026806-33026828 AGACAAGTACCCAGGAGGCCAGG + Intronic
1126584634 15:50271633-50271655 AGATAATTACTGAAGAAGCCAGG + Intergenic
1126698538 15:51346768-51346790 AAATAACAAACTAGGAGGCCGGG + Intronic
1126749318 15:51860638-51860660 AAAAAACTACATAGGAGGCCAGG + Intronic
1129432687 15:75512138-75512160 AAATAATTTAAAAGGAGGCCGGG - Intronic
1134692293 16:16198696-16198718 AAAAAATTAGCCAGGGGGCCGGG + Intronic
1134979556 16:18595982-18596004 AAAAAATTAGCCAGGGGGCCGGG - Intergenic
1136128084 16:28199837-28199859 AAAAAATTCATGAGGAGGCCAGG - Intronic
1138224917 16:55284880-55284902 AAATACTGACCAAGGAGGCTCGG - Intergenic
1138974417 16:62186589-62186611 AAATTCTTACCTGGGAGGCCTGG + Intergenic
1140235738 16:73157005-73157027 AAAAAATAAGCCAGGAGGCCGGG - Intergenic
1140979724 16:80095817-80095839 AAAAAATTATCCAGGAGTCCTGG + Intergenic
1145045006 17:19606770-19606792 AAATGATTAAGGAGGAGTCCAGG - Intergenic
1145096329 17:20031287-20031309 AAATGATTAAGCAGGAGGCCAGG - Intronic
1146899188 17:36570723-36570745 AAAGAATTACGGTAGAGGCCGGG + Intronic
1147451861 17:40510758-40510780 AAATAATGACTGTGAAGGCCAGG + Intergenic
1148108130 17:45130289-45130311 AAATAATTACAGCTGAGCCCGGG - Intronic
1148139127 17:45316384-45316406 GAAGAATTACAGAGGAGGACTGG + Intronic
1148624291 17:49057001-49057023 AAAAAATTAGCCAGGTGGCCAGG - Intergenic
1148688793 17:49514918-49514940 AAATGATTACACAGGAGGCAAGG - Exonic
1149482439 17:57014787-57014809 AAAAAATTACGCAGAAGGCCAGG + Intergenic
1149674907 17:58450791-58450813 AAATAATGATAAAGGAGGCCAGG + Intronic
1149729193 17:58927761-58927783 AAAAAATTAGCCAGGCGGCCGGG + Intronic
1150355101 17:64476382-64476404 AAATAATATTCAAGGAGGCCAGG + Intergenic
1152676355 17:81643314-81643336 AAAAAATTACCGGGACGGCCGGG + Intronic
1155592485 18:27443633-27443655 AAATAATTACTGATGCAGCCAGG + Intergenic
1156123052 18:33868195-33868217 AAAAAATTACCCAGGTGCCCAGG - Intronic
1157597716 18:48874059-48874081 CAAGAATTACAGAGAAGGCCAGG - Intergenic
1157670590 18:49525160-49525182 AAAAAATTCCTGAGCAGGCCAGG + Intergenic
1159621507 18:70644338-70644360 TAATAATTAAAGAGGAGGCCGGG + Intronic
1161690386 19:5729392-5729414 AAAGAATTACTGAGTTGGCCAGG - Intronic
1161872590 19:6881835-6881857 TAAAAATTACAGAGGGGGCCGGG + Intergenic
1162268845 19:9597760-9597782 AAAAAATTAACAAAGAGGCCAGG + Intergenic
1162805021 19:13133270-13133292 ATAGAATTACAGAGGAGGCCGGG + Intronic
1164266597 19:23624616-23624638 AAAAACTTACACAGGAGGCCGGG + Intronic
928507001 2:31964399-31964421 TAAAAATCACCGAGTAGGCCGGG + Intronic
931747494 2:65302908-65302930 TAAAAATTACTAAGGAGGCCGGG + Intergenic
932736068 2:74255586-74255608 AAATAATAACAAAAGAGGCCAGG - Intronic
935226440 2:101057010-101057032 AAATAATTCCTGAGGAGGCAGGG - Intronic
939562270 2:143746349-143746371 AAAAAATTACAGAGGATGACTGG - Intronic
940788872 2:158011058-158011080 AGATAATGAGGGAGGAGGCCGGG - Intronic
941171276 2:162140429-162140451 AAAGAATTATTGAAGAGGCCAGG - Intergenic
941192951 2:162409386-162409408 AAATAATTACCGAGTAGGAGAGG + Intronic
941412292 2:165174202-165174224 AAATAAATACACTGGAGGCCAGG - Intronic
943597473 2:189875655-189875677 AAAAAATTGCAGAGGAGGCCAGG + Intronic
945120501 2:206452509-206452531 AAAAAATAACCCAGGAGGCCAGG + Intronic
946627823 2:221633791-221633813 AAATAATAACCAAGGAAGCAGGG + Intergenic
946726377 2:222665463-222665485 AAATATGTACAGAAGAGGCCAGG - Intergenic
946875523 2:224126051-224126073 AAATACTTTCCAAGGAGACCGGG + Intergenic
948952751 2:241265121-241265143 AAATGATTGCCGTGGAGGCCGGG + Intronic
1169983430 20:11413201-11413223 AAAAAATTATTTAGGAGGCCAGG - Intergenic
1170167267 20:13374641-13374663 AAAAAATTACGAAAGAGGCCAGG - Intergenic
1170701952 20:18711889-18711911 TAAAAATTAGCCAGGAGGCCGGG + Intronic
1171249146 20:23635557-23635579 AACAAGTTACCGGGGAGGCCTGG - Intronic
1175223386 20:57430741-57430763 AAAAAATTAGCCAGGCGGCCGGG - Intergenic
1177159311 21:17530516-17530538 AAATAACTACTGTGAAGGCCGGG + Intronic
1178591504 21:33915126-33915148 AAAAAATTACCTAAGATGCCAGG + Intronic
1181769740 22:25116714-25116736 AAATACTGACTGAGGGGGCCAGG - Intronic
1182096545 22:27629945-27629967 AAATAAAGACAAAGGAGGCCAGG - Intergenic
1182857492 22:33530822-33530844 AAATAATTACATCGGAGTCCAGG - Intronic
1183417303 22:37689874-37689896 AAAAAATTAGCCAGGGGGCCAGG + Intronic
1183668902 22:39260582-39260604 AAATGATCAAGGAGGAGGCCGGG + Intergenic
1184100323 22:42338537-42338559 AAATAATTACCGAGGAGGCCCGG + Intronic
1184126080 22:42488258-42488280 AAATTATTACCTGTGAGGCCAGG + Intergenic
1184993630 22:48186799-48186821 AAATAATTAGGGAGCAGTCCGGG - Intergenic
949304673 3:2626593-2626615 AAATAATTACCCAAGAGGAGAGG + Intronic
951091799 3:18582514-18582536 AAAAAATTAACCAGGATGCCAGG + Intergenic
951293812 3:20907907-20907929 AAATAGTTTCCAAGGAGGTCAGG - Intergenic
952206885 3:31189207-31189229 TCATAATTACAGAGGAAGCCAGG - Intergenic
953339479 3:42121552-42121574 CAAGAATTCCCCAGGAGGCCAGG - Intronic
953396278 3:42573228-42573250 AAAAATAAACCGAGGAGGCCAGG + Intronic
954597342 3:51837766-51837788 AAAAAATTAGCCGGGAGGCCAGG + Intergenic
956064979 3:65388614-65388636 GAATAATTACCATGGGGGCCAGG + Intronic
956392303 3:68786303-68786325 AAATAGTTAACTATGAGGCCAGG + Intronic
959355636 3:105324483-105324505 AAAGAACTTCAGAGGAGGCCAGG + Intergenic
960291880 3:115895750-115895772 AAATCATTTCCAAGGAGCCCTGG - Intronic
960627014 3:119691126-119691148 GAATAATTATCAAAGAGGCCAGG + Intergenic
960929620 3:122832928-122832950 AAATAAATACCTGAGAGGCCGGG + Intronic
962244696 3:133782875-133782897 AAAAAATTAGCGAGGAGTGCTGG + Intergenic
963217260 3:142762329-142762351 AAAAAAATACAGAAGAGGCCAGG - Intronic
964224113 3:154377659-154377681 AAATAATTGCAGAGTGGGCCGGG - Intronic
964845956 3:161044333-161044355 AAATAAATACAGGGCAGGCCAGG - Intronic
965047843 3:163602193-163602215 AATTAAGTATCTAGGAGGCCGGG + Intergenic
967046849 3:185745345-185745367 AAATAGTTACTTGGGAGGCCAGG + Intronic
970627543 4:17905379-17905401 AAATAATGACTAAGGAGGCATGG - Intronic
970800516 4:19967305-19967327 AAATAGTTAGAGTGGAGGCCGGG + Intergenic
971138819 4:23901070-23901092 TAAAAATTAGCCAGGAGGCCGGG + Intronic
974057775 4:57001454-57001476 AAAGAAAGGCCGAGGAGGCCAGG - Intronic
975664423 4:76720903-76720925 AAATAATTCGGGGGGAGGCCGGG - Intronic
976611495 4:87035264-87035286 AAATACTCACCCAGGAGGCCTGG + Intronic
976649150 4:87416581-87416603 AAATAATAATCAAGGAGGCTGGG - Intergenic
978314739 4:107423152-107423174 AAAATATTACCAGGGAGGCCAGG + Intergenic
978901861 4:113960803-113960825 AAACAATGACCCAGGAGCCCTGG + Intronic
979143681 4:117212668-117212690 AAAAAATTATAAAGGAGGCCGGG - Intergenic
980058587 4:128103855-128103877 AAATAAAAAAAGAGGAGGCCAGG - Intronic
980337455 4:131495005-131495027 AAATCATTAAAGAGGTGGCCTGG - Intergenic
981729418 4:147882165-147882187 AAAAAATAACCTTGGAGGCCAGG + Intronic
981841999 4:149123639-149123661 AAAAATTTAGCCAGGAGGCCGGG + Intergenic
982179162 4:152734049-152734071 AGATAATTATGGAGGAGGCAGGG + Intronic
982188156 4:152824015-152824037 AAATAATTCCCCATGAGGCCAGG + Intronic
983014437 4:162594266-162594288 AAAAAATTATGGAGAAGGCCAGG + Intergenic
985301534 4:188495233-188495255 GCATAAATACCCAGGAGGCCTGG + Intergenic
986722720 5:10571495-10571517 AAATAAATACTCAAGAGGCCAGG - Intronic
986781782 5:11073013-11073035 AAAAAATTACGGAGCAGGCAAGG - Intronic
987397327 5:17436984-17437006 AATTATTTACCAAGGAGGCAAGG + Intergenic
987638635 5:20581290-20581312 AAATAATTACCAAAGAGAGCAGG + Intergenic
988479872 5:31620654-31620676 AAAGAATTAACAAAGAGGCCAGG + Intergenic
988544027 5:32140358-32140380 AAAAAATTAGCCAGGAGGCTGGG + Intronic
989221200 5:38967204-38967226 AAATAATTATCCATGAGGTCTGG + Exonic
990506276 5:56448546-56448568 AAATAAACACCAAGGAGGCAGGG + Intergenic
991393626 5:66178401-66178423 AAATAATTTCCAAGGATGCCAGG - Intronic
992724723 5:79594500-79594522 AAATAATTGCCGAGTTGGGCTGG - Intergenic
994282631 5:97924076-97924098 AAATAATTTCAGAGCAGGCTAGG + Intergenic
994587157 5:101723130-101723152 AAAAAAATACCCTGGAGGCCGGG - Intergenic
995839743 5:116432019-116432041 AAATAAGTAAAGAGGAGCCCTGG + Intergenic
1001118110 5:168956498-168956520 AAAGAATCACAGAGGGGGCCAGG + Intronic
1009542202 6:64975382-64975404 AAATAATTCCCCAGGAGGAAAGG + Intronic
1009561106 6:65244663-65244685 AAAAAATTACCCGGGAGGGCTGG - Intronic
1009956177 6:70456450-70456472 AAATAATTACCTCAGAGGACTGG + Intronic
1010201942 6:73289803-73289825 AAAAAATTAGCCAGGCGGCCGGG + Intronic
1015933359 6:138384413-138384435 GAAAAATCACTGAGGAGGCCAGG - Intergenic
1016680415 6:146822673-146822695 AAATATTTACAAAGAAGGCCAGG - Intergenic
1018866324 6:167749144-167749166 AAGTTATTACAGAGGAGGCCAGG + Intergenic
1019213987 6:170429511-170429533 AAATGTTTACCTTGGAGGCCTGG - Intergenic
1020952757 7:14701671-14701693 AAAAAATTACCGAGCTGTCCAGG + Exonic
1021491955 7:21228603-21228625 AGAGAATTACCTAGGAGGCAAGG - Intergenic
1023946403 7:44806412-44806434 GAAAAATTACCCAGGCGGCCGGG + Intronic
1026401144 7:70014009-70014031 AAAAAATAACTGATGAGGCCGGG - Intronic
1027397565 7:77771803-77771825 TAAGAATCACTGAGGAGGCCGGG - Intronic
1027459622 7:78436268-78436290 AAACAATTCCCGAGAAAGCCAGG + Intronic
1027884492 7:83886242-83886264 AAATAATTAGCCAGGAGTGCTGG + Intergenic
1028635633 7:92985858-92985880 ATATAATAACAGAGTAGGCCAGG - Intergenic
1028736202 7:94215477-94215499 AAAAAATTTCATAGGAGGCCAGG + Intergenic
1031531566 7:122883280-122883302 AGATCTTTACCCAGGAGGCCAGG - Intronic
1032861430 7:135883540-135883562 TAATAATAACATAGGAGGCCAGG + Intergenic
1034176871 7:149106811-149106833 AAATATTTAAAGAGGTGGCCAGG + Intronic
1034211814 7:149370338-149370360 AAAAAAATACAGATGAGGCCAGG - Intergenic
1034624067 7:152479009-152479031 AAAAAATTAGCCAGGTGGCCGGG - Intergenic
1036642846 8:10594777-10594799 AAATAATTAGCCAGGAGTGCTGG + Intergenic
1036969628 8:13340494-13340516 AAAAAATTAAAGATGAGGCCAGG - Intronic
1037427142 8:18768307-18768329 AAATAAATATAAAGGAGGCCAGG + Intronic
1038024599 8:23577413-23577435 GAAGAAATACGGAGGAGGCCAGG + Intergenic
1040746170 8:50644821-50644843 AATTATTTGCCAAGGAGGCCTGG - Intronic
1042183364 8:66113584-66113606 AAAGAATTACCGTGCAGGCTGGG - Intergenic
1042223636 8:66497870-66497892 AAAAAATTAGCCAGGCGGCCAGG + Intronic
1042423990 8:68624718-68624740 AAATAAATTCCCAGGAGGGCAGG - Intronic
1042549442 8:69981236-69981258 AAAAAATTACCGAGGCGTGCTGG - Intergenic
1048881247 8:138874559-138874581 AGATTATTACCCAGCAGGCCTGG - Intronic
1049028904 8:140018136-140018158 AAATAATTAGAGAGGTGGCTGGG - Intronic
1052670129 9:31546240-31546262 AAATTATTACCAAGGCTGCCAGG - Intergenic
1053196793 9:36125990-36126012 AAATAATAACTGAGCAGGCTGGG + Intergenic
1053232210 9:36419941-36419963 AAAAAACTACCGAGAAGGACTGG + Intronic
1055350864 9:75386492-75386514 AAATAATAACCAAGGAGAGCAGG + Intergenic
1059423190 9:114205520-114205542 AAGAAATTACTGAGGAGGCCTGG - Intronic
1059703138 9:116795271-116795293 AAATATTTACTGATAAGGCCGGG - Intronic
1061298712 9:129691916-129691938 AAATAAGTACCGTCTAGGCCAGG - Intronic
1061776970 9:132972124-132972146 AAATAATTAGCCAGGTGGCCAGG + Intronic
1061816192 9:133198717-133198739 AAATAATAACAGAGCAGGGCAGG + Intergenic
1062455837 9:136637975-136637997 AAGTTTTCACCGAGGAGGCCTGG - Intergenic
1186342465 X:8658931-8658953 AAAAAATTAGCAGGGAGGCCAGG + Intronic
1186801470 X:13096582-13096604 AAAAATATACAGAGGAGGCCGGG - Intergenic
1189482351 X:41402259-41402281 AAAAAATTAGCCAGGAGGCCGGG - Intergenic
1189533638 X:41913009-41913031 AAATCATTACAGAGGAGGTGAGG - Intronic
1190421503 X:50289180-50289202 AAATACTTACCTCGAAGGCCTGG - Intronic
1199163754 X:144646554-144646576 AAAAATTTACGCAGGAGGCCGGG - Intergenic