ID: 1184100324

View in Genome Browser
Species Human (GRCh38)
Location 22:42338538-42338560
Sequence AATAATTACCGAGGAGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100315_1184100324 19 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100324 22:42338538-42338560 AATAATTACCGAGGAGGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 75
1184100310_1184100324 25 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100324 22:42338538-42338560 AATAATTACCGAGGAGGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 75
1184100314_1184100324 20 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1184100324 22:42338538-42338560 AATAATTACCGAGGAGGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100324 Original CRISPR AATAATTACCGAGGAGGCCC GGG Intronic
901149927 1:7094639-7094661 CCTAATTACAGAGAAGGCCCCGG + Intronic
901168712 1:7238586-7238608 AATATTTACTGAGCAGGGCCAGG + Intronic
904220744 1:28966799-28966821 AATAAACAACGAGGAGACCCAGG + Intronic
907048494 1:51314375-51314397 AATAATTCACGAGGAGACCTGGG - Intronic
913264529 1:117031441-117031463 AATGATTACTTAGGAGGCCCTGG - Intronic
916808586 1:168284522-168284544 AACAACTAGCCAGGAGGCCCAGG + Intronic
917002293 1:170373590-170373612 AGTAATTACTGAGGAGGACGAGG - Intergenic
918100367 1:181367375-181367397 AATAAATATCCAGGAGGTCCTGG - Intergenic
920444671 1:206006912-206006934 AATATTTACCGATCAGGCACTGG + Intergenic
924333231 1:242961759-242961781 TACAAGTACCTAGGAGGCCCTGG - Intergenic
1063980660 10:11449158-11449180 AGTCATTTCCAAGGAGGCCCTGG + Intergenic
1065447609 10:25819507-25819529 AATAATTACAGGGCAGGCCCTGG - Intergenic
1070641956 10:78176749-78176771 AATAAAGGCCGGGGAGGCCCAGG + Intergenic
1071720298 10:88137170-88137192 AATAAAAACCGAGGAGGTACAGG + Intergenic
1074554246 10:114473930-114473952 AATACTTTCCGAGGATGTCCTGG + Exonic
1075533668 10:123252385-123252407 AATGCTTAGCAAGGAGGCCCAGG + Intergenic
1080859477 11:36140834-36140856 AATAATTACCTAGGAGCACGAGG + Intronic
1083455029 11:62772991-62773013 AAAAATTACCCAGGAGGCTGAGG - Intronic
1085703460 11:78765147-78765169 AATAGTATCTGAGGAGGCCCTGG + Intronic
1102425041 12:112837495-112837517 AATACTTAGCCAGGAGACCCAGG + Intronic
1103778835 12:123385884-123385906 AATAATTACCACTGAGGGCCAGG + Intronic
1106441018 13:29770294-29770316 AATTATTAACGCGGAGGTCCAGG + Intronic
1108899032 13:55374763-55374785 AATAATTACACATCAGGCCCAGG - Intergenic
1112448980 13:99492442-99492464 AATTACTACTGAGGAGCCCCAGG - Intergenic
1113905809 13:113818711-113818733 AATAGTGACGGGGGAGGCCCTGG - Intergenic
1120027165 14:79599697-79599719 AATAATTACTGAGGTGGGCCAGG + Intronic
1122694579 14:103546516-103546538 ACAAATTACCCAGGAGGGCCGGG + Intergenic
1123739292 15:23219816-23219838 AATAATGACCCAGGAGGCGGAGG + Intergenic
1124290512 15:28448776-28448798 AATAATGACCCAGGAGGCGGAGG + Intergenic
1124292725 15:28468772-28468794 AATAATGACCCAGGAGGCGGAGG - Intergenic
1128452551 15:67814316-67814338 AAAAAGGACCGAGGAGGCCGTGG - Intergenic
1130066077 15:80606120-80606142 ATTAATGTCCAAGGAGGCCCAGG - Intergenic
1133913412 16:10086548-10086570 TAAAATTACAGAGGAGCCCCAGG + Intronic
1136708236 16:32208840-32208862 AATAATGACCCAGGAGGCGGAGG - Intergenic
1136759672 16:32720566-32720588 AATAATGACCCAGGAGGCGGAGG + Intergenic
1136808432 16:33149820-33149842 AATAATGACCCAGGAGGCGGAGG - Intergenic
1138224916 16:55284879-55284901 AATACTGACCAAGGAGGCTCGGG - Intergenic
1138341963 16:56295834-56295856 AACAACTACCCAGGAGCCCCAGG - Intronic
1203061826 16_KI270728v1_random:980876-980898 AATAATGACCCAGGAGGCGGAGG + Intergenic
1146222808 17:31040100-31040122 AATAATTTCCCAGGAGGTGCTGG - Intergenic
1146342191 17:32029910-32029932 AATAATTTCCCAGGAGGTGCTGG + Intronic
1146350617 17:32089682-32089704 AATAATTTCCCAGGAGGTGCTGG - Intergenic
1148139128 17:45316385-45316407 AAGAATTACAGAGGAGGACTGGG + Intronic
1153752446 18:8246877-8246899 AATAATTACCCAGTATGCACAGG + Intronic
1165889470 19:39101808-39101830 AATAACTACCATGGAGGTCCAGG + Intronic
931022841 2:58069437-58069459 AATAAGTACCAAGGAGACCATGG - Intronic
942206139 2:173621358-173621380 AAAAATTACCTAGGTGGCCCTGG + Intergenic
946887728 2:224240564-224240586 ATTAATTACCCTGGAGGGCCAGG - Intergenic
947659853 2:231858458-231858480 AAAAATTAGCCAGGAGGACCGGG - Intergenic
1170701953 20:18711890-18711912 AAAAATTAGCCAGGAGGCCGGGG + Intronic
1179603282 21:42495663-42495685 AAGAAATGCTGAGGAGGCCCTGG - Intronic
1180652226 22:17387497-17387519 AGGAATTAACGAGAAGGCCCCGG + Intronic
1184100324 22:42338538-42338560 AATAATTACCGAGGAGGCCCGGG + Intronic
951565683 3:24010695-24010717 AAAAAATACCCAGGAGGGCCGGG + Intergenic
952206884 3:31189206-31189228 CATAATTACAGAGGAAGCCAGGG - Intergenic
953343642 3:42156852-42156874 AAAAATTACCGATGGGGGCCGGG + Intronic
955494366 3:59516201-59516223 AATAATTAGCCAGGAAGCCATGG - Intergenic
956064980 3:65388615-65388637 AATAATTACCATGGGGGCCAGGG + Intronic
956284632 3:67595659-67595681 AATAATCATCTAAGAGGCCCAGG - Intronic
963236798 3:142963877-142963899 AATCATTAACGGGGCGGCCCGGG - Intergenic
965898024 3:173602067-173602089 ACTAATTAGCTAAGAGGCCCTGG + Intronic
974248185 4:59349793-59349815 AATAATAACCCATGAGGCCTAGG - Intergenic
990389392 5:55303508-55303530 AATAATTAGTCAGGCGGCCCTGG - Intronic
992656010 5:78910184-78910206 AATAAATACTGAGGAAACCCGGG + Intronic
995297571 5:110538758-110538780 AATTACTACTGAGGAGCCCCAGG + Intronic
998985766 5:147754759-147754781 AATAATTAGCTATGAGGCCCTGG - Intronic
1013225458 6:108117233-108117255 AAGAATCCCCAAGGAGGCCCAGG + Intronic
1014171030 6:118279384-118279406 AATGAGGACCAAGGAGGCCCTGG - Intronic
1016231214 6:141806648-141806670 AATGACTACCGAGGAGGTTCTGG - Intergenic
1016473603 6:144401867-144401889 AATAATAATGGAGGAAGCCCAGG - Intronic
1019925583 7:4190200-4190222 AATAATTACCCAGGGAGCCCTGG - Intronic
1028693157 7:93676836-93676858 AATAAACACCAAGGAGGCACGGG - Intronic
1032476420 7:132214399-132214421 AATAATAACTGGAGAGGCCCAGG + Intronic
1034109787 7:148525901-148525923 AATAGTTACTGAGGAGGCTAAGG + Intergenic
1040870068 8:52091628-52091650 AAGGATTACCAAGGAGGACCAGG - Intergenic
1053211740 9:36234954-36234976 AATAATTACAGATGATGCTCTGG - Intronic
1058120274 9:101130913-101130935 ACTACTTACAGAGGAAGCCCTGG + Intronic
1186722394 X:12319406-12319428 AATTAGTATAGAGGAGGCCCTGG + Intronic
1189288224 X:39866999-39867021 TAAAATAACAGAGGAGGCCCAGG - Intergenic
1190574683 X:51821683-51821705 AATAATTAAAGATCAGGCCCAGG - Intronic
1196133769 X:112184907-112184929 AATAATCACCCAGGAATCCCAGG + Intergenic
1198678044 X:139152268-139152290 AAAAAAAACGGAGGAGGCCCCGG + Intronic