ID: 1184100325

View in Genome Browser
Species Human (GRCh38)
Location 22:42338541-42338563
Sequence AATTACCGAGGAGGCCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100310_1184100325 28 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1184100325 22:42338541-42338563 AATTACCGAGGAGGCCCGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1184100314_1184100325 23 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1184100325 22:42338541-42338563 AATTACCGAGGAGGCCCGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1184100315_1184100325 22 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100325 22:42338541-42338563 AATTACCGAGGAGGCCCGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100325 Original CRISPR AATTACCGAGGAGGCCCGGG AGG Intronic
900075582 1:814232-814254 AATGTCAGAGGAGGCCAGGGTGG - Intergenic
904733049 1:32609207-32609229 AGTTACTCAGGAGGCTCGGGTGG + Intronic
922271424 1:224039106-224039128 AATGTCAGAGGAGGCCAGGGTGG - Intergenic
1080874819 11:36265904-36265926 AAGCACCGAGGAGACCCTGGGGG + Intergenic
1091697635 12:2638735-2638757 AATTGCCCAGGAGGACTGGGAGG + Intronic
1096235647 12:49924343-49924365 GCTCACTGAGGAGGCCCGGGGGG - Intergenic
1096734635 12:53643053-53643075 AGTTACCCAGGAGGCCGAGGTGG + Intronic
1104727917 12:131088971-131088993 CATTTCCGACAAGGCCCGGGTGG + Intronic
1107099720 13:36576818-36576840 AATTCCAGAGGAGGCCAAGGAGG - Intergenic
1107227077 13:38064016-38064038 AGTTACTTGGGAGGCCCGGGTGG + Intergenic
1112028367 13:95433925-95433947 TATCACCGAGGAGGCTCGCGTGG - Intronic
1113847618 13:113401612-113401634 ATTTATAGAGGAGGCCCCGGGGG + Intergenic
1117859161 14:60072043-60072065 AATGACAGAACAGGCCCGGGAGG - Intergenic
1128069114 15:64783017-64783039 AATTGCCCAGCATGCCCGGGAGG + Intergenic
1128893723 15:71354047-71354069 AGCTACCCAGGAGGCCGGGGTGG + Intronic
1130669404 15:85898455-85898477 AATTACAGAGGGGGCTCAGGAGG - Intergenic
1140228832 16:73100658-73100680 AATTACCCAGGAGGCAGAGGTGG - Intergenic
1141790693 16:86232312-86232334 AATTGCCAAGGAGGCCTGGCAGG - Intergenic
1141806435 16:86344771-86344793 AATGACAGAGGTGGCCTGGGAGG + Intergenic
1149651495 17:58279062-58279084 AGTGACGAAGGAGGCCCGGGCGG + Exonic
1152608606 17:81304994-81305016 ACCTACCGTGGAGGCCAGGGAGG - Intergenic
1158492495 18:57922843-57922865 AATTACTCAGGAGGCCGAGGTGG - Intergenic
1159492354 18:69153505-69153527 AGCTACCGAGGAGGCCGAGGAGG + Intergenic
1161084937 19:2330617-2330639 CACCACCAAGGAGGCCCGGGGGG + Intronic
1161741092 19:6021662-6021684 GAATAGCGAGGAGGCCCGTGTGG + Intronic
1164736940 19:30548576-30548598 AGTTACCGAGGAGCCCGGGAGGG - Exonic
1166995715 19:46718824-46718846 GATTACCGAGGACGCCTGGCTGG + Intergenic
1167143832 19:47670691-47670713 GATGACCCAGGAGGCCCAGGTGG - Intronic
1167253982 19:48416139-48416161 GATTACCGAGGAAGGCCGAGGGG - Exonic
931411078 2:62032421-62032443 AGCTACAGAGGAGGCTCGGGTGG + Intronic
947521636 2:230850163-230850185 AATGACAGAGGAAGCCGGGGAGG + Intergenic
949082141 2:242110569-242110591 AATGTCAGAGGAGGCCAGGGTGG + Intergenic
1170701954 20:18711893-18711915 AATTAGCCAGGAGGCCGGGGTGG + Intronic
1172886006 20:38231263-38231285 AACTACAGAGGGGGCCTGGGAGG - Exonic
1173985815 20:47260433-47260455 GATTAGCAAGGAGGCCAGGGTGG - Intronic
1175181123 20:57148409-57148431 AATTACAGAGGTTGCGCGGGCGG + Intergenic
1176035294 20:63033478-63033500 CAGACCCGAGGAGGCCCGGGTGG - Intergenic
1179001807 21:37468222-37468244 AATTACTCAGGAGGCTCGGGTGG - Intronic
1183732122 22:39624391-39624413 AATTACAGAGGAGCTCCGAGCGG + Intronic
1184100325 22:42338541-42338563 AATTACCGAGGAGGCCCGGGAGG + Intronic
950017682 3:9765802-9765824 CATTGCCAAGGAGGCCCTGGAGG - Exonic
950683704 3:14602358-14602380 AAGTTGCGAGGAGGCCAGGGAGG - Intergenic
950746410 3:15093502-15093524 AATTACCCAGGAGGCTGAGGTGG - Intronic
952087186 3:29838224-29838246 ACCTACTGAGGAGGCCAGGGTGG + Intronic
954030522 3:47816688-47816710 AGTTACCGAGGAAGCCCAGGTGG + Intronic
957113986 3:76001648-76001670 AATTACCCAGGAGGCTGAGGTGG - Intronic
967330258 3:188282970-188282992 AATTACTGAGGAGGCCTGAGGGG + Intronic
968587309 4:1426128-1426150 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968587323 4:1426178-1426200 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968587353 4:1426328-1426350 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968587365 4:1426378-1426400 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968587379 4:1426428-1426450 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968587389 4:1426478-1426500 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968587415 4:1426578-1426600 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968587428 4:1426628-1426650 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968587441 4:1426678-1426700 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968587456 4:1426728-1426750 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968587470 4:1426778-1426800 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968587491 4:1426878-1426900 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968587501 4:1426928-1426950 AATTGAAGAGGAGGCCGGGGCGG - Intergenic
968648924 4:1752830-1752852 AAATGCCGAGGAGGCCTGGCCGG - Intergenic
982090349 4:151875140-151875162 AAGCACCGAGGAGGCCCATGTGG + Intergenic
985108847 4:186526731-186526753 AATGACCCAGGAGGCTCAGGTGG - Intronic
985913310 5:2899212-2899234 AATTACCCAGGAGGCCCATCTGG - Intergenic
987310764 5:16679174-16679196 AATTCCCAAGGAGCCCAGGGTGG - Intronic
1003212451 6:4079429-4079451 AAGGCCCGAGAAGGCCCGGGAGG - Exonic
1004709200 6:18154658-18154680 AGTTACCGAGGAGGCTGGGGCGG + Intronic
1006408233 6:33857289-33857311 AATTACTCTGGAGGCCAGGGAGG - Intergenic
1006728959 6:36221141-36221163 AAATACTGATGATGCCCGGGTGG + Intronic
1007239549 6:40415168-40415190 AATCAGCGAGGAGGCACAGGAGG - Intronic
1008551889 6:52640449-52640471 AATTACCTGGGAGGCCAAGGCGG + Intergenic
1019743765 7:2688403-2688425 AAGTCCCGAGGGCGCCCGGGCGG + Intronic
1023011168 7:35925917-35925939 AGCTACCGAGGAGGCTGGGGTGG + Intergenic
1025124809 7:56336009-56336031 AGCTACCGAGGAGGCTGGGGTGG + Intergenic
1026819610 7:73537988-73538010 AACTTCCGAGGAGGGCAGGGAGG + Exonic
1031468765 7:122144792-122144814 AACTACCTAGGAGGCCTGGAGGG + Intergenic
1032400471 7:131620754-131620776 AAATTCCAAGGAGGCCTGGGAGG - Intergenic
1035243871 7:157550051-157550073 AAGACCTGAGGAGGCCCGGGTGG + Intronic
1035540056 8:427280-427302 AATGTCAGAGGAGGCCAGGGTGG + Intronic
1037548218 8:19944413-19944435 AATTACTGAGGAAGCCCTGTAGG + Intronic
1038445877 8:27603970-27603992 AATCACCGGGGAGTCCCAGGGGG + Intronic
1039736231 8:40335773-40335795 AATTTCTCAGGAGCCCCGGGTGG - Intergenic
1040391550 8:46954842-46954864 GATCACCCTGGAGGCCCGGGCGG - Intergenic
1042887386 8:73567658-73567680 AATTACTCAGGAGGCCAAGGTGG - Intronic
1048868370 8:138777198-138777220 AATCAACAAGGAGGCCTGGGTGG - Intronic
1049536710 8:143185945-143185967 AATTACGGCGGAGGCCCTGGGGG + Intergenic
1052914416 9:33913369-33913391 AGTTACTCAGGAGGCCCAGGTGG - Intronic
1056580802 9:87887114-87887136 AGATACCCAGGAGGCCCAGGGGG - Exonic
1058840993 9:108908936-108908958 AAATAGCCAGGAGGCCAGGGTGG - Intronic
1059423189 9:114205516-114205538 AATTACTGAGGAGGCCTGGCTGG - Intronic
1059750752 9:117245099-117245121 CATTACCGTGGAGGCCACGGAGG - Intronic
1062679605 9:137771670-137771692 TCTTACCGAGGAGACCGGGGTGG + Intronic
1196692214 X:118571961-118571983 AATAACCAAGGAGGCCAGTGTGG + Intronic