ID: 1184100325

View in Genome Browser
Species Human (GRCh38)
Location 22:42338541-42338563
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100315_1184100325 22 Left 1184100315 22:42338496-42338518 CCGAAGAGCTCGCTCAGGGGCTG No data
Right 1184100325 22:42338541-42338563 AATTACCGAGGAGGCCCGGGAGG No data
1184100314_1184100325 23 Left 1184100314 22:42338495-42338517 CCCGAAGAGCTCGCTCAGGGGCT No data
Right 1184100325 22:42338541-42338563 AATTACCGAGGAGGCCCGGGAGG No data
1184100310_1184100325 28 Left 1184100310 22:42338490-42338512 CCAATCCCGAAGAGCTCGCTCAG No data
Right 1184100325 22:42338541-42338563 AATTACCGAGGAGGCCCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type