ID: 1184100329 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:42338548-42338570 |
Sequence | GAGGAGGCCCGGGAGGGAGG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1184100314_1184100329 | 30 | Left | 1184100314 | 22:42338495-42338517 | CCCGAAGAGCTCGCTCAGGGGCT | No data | ||
Right | 1184100329 | 22:42338548-42338570 | GAGGAGGCCCGGGAGGGAGGCGG | No data | ||||
1184100315_1184100329 | 29 | Left | 1184100315 | 22:42338496-42338518 | CCGAAGAGCTCGCTCAGGGGCTG | No data | ||
Right | 1184100329 | 22:42338548-42338570 | GAGGAGGCCCGGGAGGGAGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1184100329 | Original CRISPR | GAGGAGGCCCGGGAGGGAGG CGG | Intronic | ||