ID: 1184100488

View in Genome Browser
Species Human (GRCh38)
Location 22:42339515-42339537
Sequence AAGTGAGGAGTTGGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100475_1184100488 29 Left 1184100475 22:42339463-42339485 CCCATAGCGACTAAACCCAGCAT No data
Right 1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG No data
1184100480_1184100488 13 Left 1184100480 22:42339479-42339501 CCAGCATTCTCTGGGCAGCGAAC No data
Right 1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG No data
1184100476_1184100488 28 Left 1184100476 22:42339464-42339486 CCATAGCGACTAAACCCAGCATT No data
Right 1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG No data
1184100479_1184100488 14 Left 1184100479 22:42339478-42339500 CCCAGCATTCTCTGGGCAGCGAA No data
Right 1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100488 Original CRISPR AAGTGAGGAGTTGGGGCAGC TGG Intronic