ID: 1184100488

View in Genome Browser
Species Human (GRCh38)
Location 22:42339515-42339537
Sequence AAGTGAGGAGTTGGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 441}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184100479_1184100488 14 Left 1184100479 22:42339478-42339500 CCCAGCATTCTCTGGGCAGCGAA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG 0: 1
1: 1
2: 3
3: 43
4: 441
1184100476_1184100488 28 Left 1184100476 22:42339464-42339486 CCATAGCGACTAAACCCAGCATT 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG 0: 1
1: 1
2: 3
3: 43
4: 441
1184100475_1184100488 29 Left 1184100475 22:42339463-42339485 CCCATAGCGACTAAACCCAGCAT 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG 0: 1
1: 1
2: 3
3: 43
4: 441
1184100480_1184100488 13 Left 1184100480 22:42339479-42339501 CCAGCATTCTCTGGGCAGCGAAC No data
Right 1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG 0: 1
1: 1
2: 3
3: 43
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184100488 Original CRISPR AAGTGAGGAGTTGGGGCAGC TGG Intronic
900094014 1:933066-933088 AGGTCAGGAGGTGGGGAAGCTGG - Intronic
900984654 1:6066317-6066339 AGGTGGGGAGTTGGGGAGGCCGG - Intronic
901241131 1:7694148-7694170 GGGTGAGGAGTAGGGGAAGCAGG - Intronic
902383781 1:16065089-16065111 AAGTGAGGAGTCAGGGCTGGAGG - Intronic
902553466 1:17232969-17232991 AAGTGAGGGGCTGGGGCGGGAGG + Exonic
902707970 1:18219481-18219503 CAGTGAGGAGATGGAGCAGTAGG + Intronic
902795624 1:18799031-18799053 AAGTGAGAAGGGGGAGCAGCTGG + Intergenic
902814079 1:18906139-18906161 GAGTGAGGACTTGGGGCAGGTGG - Exonic
903562105 1:24236043-24236065 AAGGGAGGAGTGGGGTCTGCGGG - Intergenic
903584386 1:24399880-24399902 TGGTGAGGATTTGGAGCAGCTGG + Intronic
903607756 1:24587434-24587456 AACAGAGCAGTTGGGGTAGCTGG - Intronic
903687766 1:25144787-25144809 AAAGGAGGAGTGGGGGCAGAGGG + Intergenic
904125131 1:28232889-28232911 GAGTGAGGAGTAGTGGCACCGGG - Intronic
904848764 1:33441118-33441140 AAGTGAGGACGTGGAGCAGGAGG + Intergenic
905823986 1:41015647-41015669 AAGTCAGGGGTGGGGGCTGCAGG + Exonic
906353810 1:45085624-45085646 GAGTGATGATTTGGGGCATCTGG - Intronic
906495177 1:46300757-46300779 GTGTAAGGAGTTGGGGCAGCGGG - Intronic
909352695 1:74673425-74673447 GAGGGAGGAGGAGGGGCAGCTGG + Intronic
909743733 1:79066128-79066150 AAGGGAGGAGTTGGGGATCCAGG + Intergenic
910625840 1:89305488-89305510 AAGTGAGGTGATGGGGTAGGAGG + Intergenic
911285672 1:95989155-95989177 AAGTGGGGGGTTGGGGGAGAAGG - Intergenic
911573412 1:99545035-99545057 TAGTGAGGAGTGGGGGTAGAGGG - Intergenic
912877576 1:113377076-113377098 AAGGGAGGAGTTGGGGGAGAGGG - Intergenic
913071957 1:115307295-115307317 AAATGAGAAGTGGGGGAAGCAGG + Intronic
913117908 1:115713561-115713583 AAGAAAGTGGTTGGGGCAGCTGG + Intronic
913427111 1:118745328-118745350 TAGAGAGGAATTGGGGGAGCGGG - Intergenic
914000422 1:143690015-143690037 AAGTGAGGAGTTTATGTAGCAGG - Intergenic
917288081 1:173442351-173442373 TGGGGAGGAGTTGGGGGAGCAGG - Intergenic
917526462 1:175792552-175792574 AAAGGAGGGGTTGGAGCAGCTGG + Intergenic
917594907 1:176519375-176519397 AGGTGAGGAGGTGGGGCTGGTGG + Intronic
918294867 1:183146994-183147016 AGGTGAGGAGGTGGGAAAGCAGG + Intergenic
920728515 1:208460920-208460942 GAGTGGGGAATTGGGGCAGGGGG - Intergenic
921152053 1:212410497-212410519 GAGTGAGGAGTTGGTCCAGGTGG - Exonic
921643249 1:217581530-217581552 CAGTGAGAAGTTGGGGGAGGTGG - Intronic
923373657 1:233338587-233338609 AAGTGAGGAAATGGGTCATCTGG + Intronic
924071550 1:240285415-240285437 AAGTGAGGAGTTCAGGAAGGAGG + Intronic
1063629861 10:7723284-7723306 AGGAGAGGAGGTGGGGGAGCAGG + Intronic
1066365990 10:34777385-34777407 ATGTGAGGACATGGGGCTGCAGG - Intronic
1066591540 10:37000335-37000357 ATGTAAGGAGTTAGGGCATCTGG - Intergenic
1068137108 10:52961547-52961569 AACTGAGGAGTAGAGACAGCTGG - Intergenic
1068879795 10:62036137-62036159 AAGCGAGGAGTTAGGGCAGGAGG + Intronic
1069248597 10:66241637-66241659 ACGTGAGGAGGTGGGGGGGCTGG - Intronic
1069621076 10:69837627-69837649 AAGTGAGGAGAAGAGGCAGTGGG - Intronic
1069683072 10:70299140-70299162 AGGTGAGGACCTGGGGCAGCAGG + Exonic
1070398963 10:76036150-76036172 GGGTGGGGAGTGGGGGCAGCGGG - Intronic
1071218538 10:83435451-83435473 AAGTGAGGAGGTGGGAGAACAGG - Intergenic
1072564938 10:96609691-96609713 AAGTGAGCAGCTGGGGGTGCGGG - Exonic
1072759817 10:98047287-98047309 AAGTGGGAATCTGGGGCAGCTGG - Intergenic
1072821179 10:98559417-98559439 GAGTGTAGAGTTGGGGCAGGGGG - Intronic
1073295658 10:102436852-102436874 AAGTGTGGAGCCGGAGCAGCAGG - Intergenic
1073501262 10:103939750-103939772 GAGTGAGGAGGTGGGAAAGCTGG + Intergenic
1073585826 10:104709016-104709038 AAGCGAGGAGATGGGCCAGGTGG - Intronic
1074623861 10:115156098-115156120 AAGTGAGGAGTCAGGGGAACAGG + Intronic
1074937262 10:118193837-118193859 AAGATGGGAGTAGGGGCAGCTGG - Intergenic
1075548426 10:123373753-123373775 AAGTCAGGCGTTTGGCCAGCAGG - Intergenic
1076353573 10:129835483-129835505 AAGTGAGGGCATGGGGAAGCTGG + Exonic
1076392139 10:130110980-130111002 AAGTAATGACTTGGGGCAGACGG - Intergenic
1077484844 11:2833933-2833955 GGGTGAGGAGGTGGGGGAGCAGG - Intronic
1078396973 11:10989731-10989753 AAGACAGGAGATGGGGCTGCTGG + Intergenic
1078476209 11:11632613-11632635 CAGGGAGGAGCTGGGGGAGCTGG + Intergenic
1078866439 11:15302376-15302398 AAGTGGGGAGTTGGAGAAGCAGG - Intergenic
1079309549 11:19352538-19352560 AAGTGAGGCTCTGCGGCAGCTGG + Intronic
1079343453 11:19631987-19632009 AAGTGGGCAGTTGGCACAGCTGG - Intronic
1079533232 11:21480363-21480385 AAGTGAGAAGTTACAGCAGCAGG + Intronic
1080186538 11:29494122-29494144 AAGTGAGGAGTTGAGGGAGGTGG + Intergenic
1080673702 11:34405375-34405397 AAGTGAGGAGATGGGAGAGAAGG - Intergenic
1080754028 11:35178338-35178360 AAGTGAGGGGTTTGGCCAGGTGG - Intronic
1080896425 11:36452287-36452309 AAGTGAGAAGAGGGGGCATCAGG - Intronic
1081644308 11:44779038-44779060 AAGTGAGGAGCTGTGGCCACTGG + Intronic
1083778755 11:64907322-64907344 AAGTGAAGACTTGGGGCCTCAGG + Exonic
1083996476 11:66275568-66275590 TGTTGAGGTGTTGGGGCAGCTGG + Intronic
1084299510 11:68237915-68237937 AAGTGAGGAGATGGAGCTGGAGG + Intergenic
1084457247 11:69274951-69274973 AGGGGAGGAGTGGGGGGAGCAGG + Intergenic
1084472785 11:69372995-69373017 GAGTGAGGAGTCCGGGCGGCTGG + Intergenic
1084946300 11:72640649-72640671 CAGAGAGGAGTTGGGGCAGGGGG - Intronic
1085064293 11:73478886-73478908 AAGTGGGGTGATGGGGGAGCAGG + Intronic
1085494523 11:76955747-76955769 AACTGGGGAGTTGGGGAGGCAGG + Intronic
1085753353 11:79182914-79182936 TAGTGAGGATGTGGAGCAGCAGG + Intronic
1086759214 11:90606098-90606120 AGGTGAGGAGTTGAGGCAGGAGG + Intergenic
1088599322 11:111461358-111461380 AAGAGAGGAGTGGGGGCAGGAGG + Intergenic
1089209838 11:116792359-116792381 AGGTGAGCAGCTGGGGCAGAGGG - Exonic
1090407646 11:126486750-126486772 GACTGAGTGGTTGGGGCAGCAGG - Intronic
1090716242 11:129433768-129433790 AAGTGTGAAGATGGGGCAGGTGG - Intronic
1090748130 11:129723487-129723509 GAGGGAGGTGTTGGGGCTGCAGG - Intergenic
1091079245 11:132651082-132651104 AATTCTGGGGTTGGGGCAGCAGG - Intronic
1091326951 11:134698370-134698392 CTGTGAGGAGGTGAGGCAGCTGG - Intergenic
1091396428 12:156479-156501 CTGTGGGGAGCTGGGGCAGCTGG + Intronic
1092112646 12:5974736-5974758 CAGTGAGGAGCTGGAGCAGACGG + Intronic
1092302001 12:7260190-7260212 AGGAGAGAAGTTGGGGCAGGAGG + Intergenic
1093184453 12:16003757-16003779 CAGTGAGGAGTTATGGAAGCTGG - Intronic
1093228121 12:16510249-16510271 AAGGGAGGAGGTGGGGAAGAAGG + Intronic
1096460004 12:51817007-51817029 AATAGAGGAGTGGGGGCAGGTGG + Intergenic
1096480985 12:51940896-51940918 AAGTGAGGAGATAGGGCTGCTGG + Intergenic
1096659840 12:53117610-53117632 AGGTGAGAAGTTGGGGTAGAAGG + Intronic
1096686534 12:53291859-53291881 AGGTAAGGAGCTGGGGCAGAGGG + Exonic
1097334360 12:58365739-58365761 GGGTGAGGAGTTGGGGAAGGGGG + Intergenic
1100481394 12:94983083-94983105 AAGAGTGGAGTAGGGGGAGCAGG - Intronic
1102444292 12:112989870-112989892 GAGTGAGGAGGTGGGGGAGCTGG - Intronic
1102708652 12:114905758-114905780 AAGTGAGTAGGTGCAGCAGCTGG - Intergenic
1103205024 12:119122153-119122175 GTTTGAGGAGTTGGGGCATCTGG + Intronic
1103928429 12:124436347-124436369 GAGAGAGGAGGTGGGGCAGGGGG + Intronic
1105841002 13:24253665-24253687 ATGTGAGGAGTAGGAGCAGGTGG + Intronic
1106032045 13:26012679-26012701 TGATGAGGAGTTGGGGGAGCGGG + Intronic
1106105033 13:26725328-26725350 TAGTGAGGATATGGGGCAACAGG - Intergenic
1108499000 13:51051753-51051775 AAGAGAGGAGTTTGAGTAGCTGG - Intergenic
1108876494 13:55056168-55056190 AAGAGAGGGGTTCGGGCTGCAGG - Intergenic
1111690476 13:91557214-91557236 AAGTGAAAAATTGGAGCAGCAGG - Intronic
1113802992 13:113096129-113096151 GCGTGAGGGGCTGGGGCAGCTGG + Intronic
1114476446 14:22998537-22998559 GATTGAGGAGCTGCGGCAGCTGG - Exonic
1114725835 14:24936243-24936265 ATGTGAGGAGGAGGGGGAGCAGG - Intronic
1115304691 14:31922196-31922218 AAGGGAGGAGCTGGGGCAGCCGG - Intergenic
1115760992 14:36579670-36579692 AGGAGAGCAGTTGGGGCATCAGG - Intergenic
1116733445 14:48656286-48656308 TAGTGAGGATTTGGGGCAAGTGG + Intergenic
1116763262 14:49040343-49040365 AAGTAAGGAGTTGGAGCAAAAGG + Intergenic
1117153807 14:52917021-52917043 TAGTGAGGATTTGTGGCAACGGG + Intronic
1118894082 14:69931340-69931362 GAAGGAGGAGTTGGGGCAGCTGG - Intronic
1119035652 14:71228357-71228379 AAGTTAGGAGTTGAGGCTTCTGG - Intergenic
1120516967 14:85482195-85482217 AAGTGAGTAGGTGGGGCAGGAGG + Intergenic
1121501078 14:94438633-94438655 AAGAGAAGGGGTGGGGCAGCTGG + Intergenic
1121544029 14:94750656-94750678 ATCTGAGGGGCTGGGGCAGCAGG - Intergenic
1121649948 14:95550548-95550570 AAGTGAGAACTTGGGGCAACAGG - Intergenic
1122788731 14:104175639-104175661 AACTGAGGAGGTGGGGGAGCCGG - Exonic
1122853869 14:104550782-104550804 CAGTGTGGAGTTGCTGCAGCTGG + Intronic
1123848028 15:24324324-24324346 AAGTGAGCAGTAGGGGAAGGGGG + Intergenic
1123867075 15:24531687-24531709 AAGTGAGCAGTAGGGGAAGGGGG + Intergenic
1125512622 15:40300982-40301004 AAGGGAGGAGCTCAGGCAGCAGG + Intronic
1125800904 15:42445938-42445960 GAGTGTGGAGGTGGGGCAGCGGG + Intronic
1125991552 15:44113689-44113711 AAGTGGGGAGGAGGGGAAGCGGG - Intronic
1126212732 15:46118222-46118244 AAGTGAGAAGTTGTGGCATTTGG - Intergenic
1127191058 15:56531066-56531088 AAGAAAGCAGTAGGGGCAGCAGG + Intergenic
1127403179 15:58612642-58612664 CAGTGACGAGTTGGGTCACCGGG - Intronic
1128283396 15:66416064-66416086 GAGTGATGAGATGGGGCTGCAGG - Intronic
1128575334 15:68770428-68770450 AAGTGAGGGTGTGGGGCTGCAGG + Intergenic
1129333780 15:74840677-74840699 AAGTCAGGAGCTGAAGCAGCTGG - Intronic
1129486836 15:75881744-75881766 AAGATGGGAGTTGGGGCAGGAGG + Intronic
1129506322 15:76084496-76084518 AAGTGATGAGTTTGGGCAACTGG + Intronic
1130270305 15:82442705-82442727 CTGTGTGGAGCTGGGGCAGCGGG + Intergenic
1130275663 15:82475124-82475146 CTGTGTGGAGCTGGGGCAGCGGG - Intergenic
1130462648 15:84170026-84170048 CTGTGTGGAGCTGGGGCAGCGGG + Intergenic
1130468022 15:84202516-84202538 CTGTGTGGAGCTGGGGCAGCGGG - Intergenic
1130490030 15:84424767-84424789 CTGTGTGGAGCTGGGGCAGCGGG - Intergenic
1130496244 15:84471026-84471048 CTGTGTGGAGCTGGGGCAGCGGG + Intergenic
1130501616 15:84503517-84503539 CTGTGTGGAGCTGGGGCAGCGGG - Intergenic
1130590314 15:85207114-85207136 CTGTGTGGAGCTGGGGCAGCGGG - Intergenic
1130949642 15:88575378-88575400 AAGTGTGAAGTTGGAGAAGCAGG + Intergenic
1132060930 15:98691959-98691981 GAGTGAGGACATGGGGCAACAGG - Intronic
1132814560 16:1819548-1819570 AAGTAAAGAATTGGGGCAGATGG - Intronic
1133019661 16:2961758-2961780 AGGTGAGAAGTTGGGGGACCTGG - Intergenic
1133723401 16:8515918-8515940 AAGTGAGTAGCTGGGACTGCAGG - Intergenic
1136065801 16:27757515-27757537 AGGTCAGGAGCTGGGTCAGCAGG - Intronic
1136239296 16:28934342-28934364 GAGTGAGGAGTTGGGGAGGAAGG - Intronic
1136909618 16:34135130-34135152 AAGTGAGAGGTTGGGACAGAGGG - Intergenic
1137345813 16:47658142-47658164 AACAGAGTAGATGGGGCAGCTGG - Intronic
1137951851 16:52791474-52791496 GAGAGAGGAGTTAGGGCATCTGG + Intergenic
1137985021 16:53099949-53099971 AGGTGGGGAGTTGAGTCAGCTGG + Intronic
1138117942 16:54375129-54375151 AACTGAGGAGTTGAGGGTGCTGG + Intergenic
1138453228 16:57106108-57106130 ATGTCTGGAGTTGGGGCAGGCGG - Intronic
1138459856 16:57141652-57141674 AAGTCAGGAAGTGGGGGAGCTGG - Intronic
1138512402 16:57516229-57516251 CAGGGAGGAGTGGGGGCCGCAGG - Intronic
1138537700 16:57668498-57668520 AGGTGAGGAGTTGGGGTGTCTGG + Intronic
1139010535 16:62627380-62627402 AAGAGAGGAGATGGGGGAGCTGG - Intergenic
1140864077 16:79044437-79044459 GAGTGAGTTGTTGGGGGAGCTGG + Intronic
1141509654 16:84504408-84504430 AGGTGAGGGGTGGGGACAGCGGG - Intronic
1141615748 16:85208477-85208499 GAGTCAGGAGCTGAGGCAGCAGG - Intergenic
1142151190 16:88513206-88513228 AAGAGCGGACTGGGGGCAGCAGG - Intronic
1142478185 17:202006-202028 GAGTGAGGGGTTGAGGCAGGAGG - Intergenic
1142675459 17:1510614-1510636 AAGGGAGGAATGGGGGCAGCTGG - Intronic
1142856172 17:2731562-2731584 CAGTGAGGAGGAGGGGCAGAGGG - Intergenic
1143130690 17:4675131-4675153 AATTGAGGACCTGGGGAAGCAGG + Exonic
1143156230 17:4838404-4838426 GAGTGAGGGGGTGGGCCAGCTGG - Intronic
1143216866 17:5231702-5231724 AAGTGAGGAGATGGGAAAACAGG - Intronic
1145996142 17:29106089-29106111 AAGAGAGGAGTGGGACCAGCAGG + Intronic
1146468982 17:33109459-33109481 GACTGGGGAGTTGGGGAAGCAGG - Intronic
1147407383 17:40221975-40221997 AAGTTAAGAGTTGGGGAAGGTGG + Intronic
1147407517 17:40223065-40223087 AAGTTAAGAGTTGGGGAAGGTGG + Intronic
1147987004 17:44312547-44312569 AGGTGGGGAGATGGGGCAGTGGG - Intronic
1148283566 17:46368328-46368350 AAGAGAGGAGGGGGTGCAGCGGG + Intergenic
1148305784 17:46586253-46586275 AAGAGAGGAGGGGGTGCAGCGGG + Intergenic
1148687810 17:49510361-49510383 AAGGGAGGAGTGGGGGAAGTGGG + Intronic
1148704463 17:49617058-49617080 AAGACAGGGGTTGGAGCAGCTGG + Intronic
1148728548 17:49815299-49815321 AAGGGAGGGGCAGGGGCAGCTGG - Intronic
1148734744 17:49858999-49859021 GGGTGGGGAGCTGGGGCAGCAGG + Intergenic
1148810122 17:50284971-50284993 TAGTGCGGAGGTGGGGCAGGGGG + Intergenic
1149536965 17:57440745-57440767 GACTGAGGAGGTGGGGAAGCAGG + Intronic
1149658460 17:58322633-58322655 AGGTGAGGAGATGGTGCAGGTGG - Exonic
1149918667 17:60635689-60635711 GAGTGAGGCCTAGGGGCAGCAGG - Intronic
1150840435 17:68601206-68601228 GAGTGGGGAGTTGGCGAAGCAGG + Exonic
1151365478 17:73613710-73613732 AATAGAAGAGGTGGGGCAGCTGG - Intronic
1152071035 17:78133714-78133736 GAGTGAGGAGTCGGGGTAGGGGG - Intronic
1153374255 18:4357607-4357629 AAGAGAAGAGTTGGTGTAGCTGG + Intronic
1153471972 18:5456922-5456944 CAGTGAGAAGCTGGAGCAGCAGG + Intronic
1153574962 18:6511074-6511096 AGGTAAGGGGTTGGGGGAGCAGG + Intergenic
1153871018 18:9320218-9320240 AAGTGTGCAGTTGCAGCAGCTGG - Intergenic
1154396732 18:13997691-13997713 AAGTGAGGAGATGGGCCACATGG + Intergenic
1155399105 18:25418598-25418620 AGGTGAGGACTTGGGGTTGCGGG + Intergenic
1156472795 18:37388045-37388067 AAGGCAGGAGTTGGGGGAGGGGG + Intronic
1157302531 18:46489283-46489305 AAGTGAGGGGTTGGGTTAGGTGG + Intronic
1158953972 18:62523014-62523036 GGGTGAGGAGGTGGAGCAGCCGG - Exonic
1159089767 18:63834473-63834495 AAGTGAGTTGTGGGGGCAGGAGG + Intergenic
1160033161 18:75279554-75279576 AATTGAGGAGCTGGAGCAGGAGG + Intronic
1160406784 18:78651797-78651819 AGGTGGGGAGCTGGGGCCGCTGG + Intergenic
1160452820 18:78977593-78977615 CAGTGAGGAGTTGGTGCCGCCGG + Intergenic
1160782274 19:883180-883202 AAGTGGGGATGTGGGGCAGTGGG + Intronic
1161279678 19:3439000-3439022 CAGTGAGGAGCTCGGGCAACTGG + Intronic
1161744539 19:6047648-6047670 AAGTGAGGAGCTGCGGAAACAGG + Intronic
1161852773 19:6746199-6746221 AAGTGAGGCCTCGGGGCAGGAGG + Intronic
1162082216 19:8224986-8225008 ACGGGAGGTATTGGGGCAGCAGG + Intronic
1162392240 19:10396506-10396528 AAGTGAGGGGCTGGTGTAGCTGG - Intronic
1162433714 19:10644273-10644295 AAGTGAGGTGTGTGGGCAGAGGG - Exonic
1164236491 19:23341172-23341194 TCCTGAGGAGTTGGGGCTGCAGG + Intronic
1165060823 19:33204499-33204521 ACATGAGGAGTGGGGGCAGCCGG + Intronic
1165067484 19:33237448-33237470 AAGTGAGGAGATGGGAGCGCTGG - Intergenic
1165133050 19:33645193-33645215 AAGTCAGGAGTTGGGGGACAGGG + Intronic
1165350676 19:35273461-35273483 AAGTGAGTAGATGGGGGTGCCGG + Intronic
1165573008 19:36791436-36791458 TAGGGGGGAGTTGGGGGAGCAGG - Intergenic
1165632332 19:37312454-37312476 TAGGGGGGAGTTGGGGGAGCAGG - Intergenic
1165723561 19:38096713-38096735 TAGTGAGGATGTGGAGCAGCAGG + Intronic
1165747805 19:38240659-38240681 AAGCCAGGAGGTGGGGCAGTCGG + Intergenic
1166020373 19:40023408-40023430 AAGTGAGGATTGGAGGGAGCTGG + Intergenic
1166126048 19:40716011-40716033 ACAAGAGGGGTTGGGGCAGCGGG - Intronic
1166361756 19:42255429-42255451 AGGAGAGGAGGAGGGGCAGCAGG - Intergenic
1167285325 19:48596033-48596055 CAGTGAGGAGCAGGGTCAGCTGG + Intronic
1167493210 19:49803441-49803463 AAGTGTGGACCTGGGTCAGCCGG - Intronic
1168516138 19:57011710-57011732 AAATGAGGATCTGGGGCAGTGGG - Intergenic
1168538877 19:57193913-57193935 CAAGGAGGAGTGGGGGCAGCTGG + Exonic
925507459 2:4584221-4584243 AAGTGAGGAGGTGGGGGAGCAGG - Intergenic
925645280 2:6029540-6029562 AAATGAGGAATTGGGGGAGGGGG + Intergenic
925733949 2:6944121-6944143 AAGTGAGGAGAGAGGACAGCGGG + Intronic
928204765 2:29276077-29276099 AATTGAGGGGTCGGGGCAGCAGG - Intronic
928645251 2:33345327-33345349 AAGGCAGGAGTTGGGACTGCTGG + Intronic
929019146 2:37533090-37533112 AGGTGAGGGGCTGGGGCAGAGGG + Intergenic
929190628 2:39136190-39136212 AAGTGAGGGGCTAGGGCAGCAGG - Intergenic
930365814 2:50438088-50438110 AAGTCAGGTTTTGGGGCAGTAGG - Intronic
931427371 2:62183513-62183535 TGGTGAGGTGTTGGAGCAGCTGG + Intergenic
931662960 2:64585784-64585806 AAGTGAGGTGGGGGGGCAGGGGG - Intronic
931859945 2:66344550-66344572 ATGTGATGGGGTGGGGCAGCTGG + Intergenic
932733009 2:74233630-74233652 AGTTGAGGAGGTGGGACAGCAGG - Intronic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
934993883 2:98939611-98939633 AGGTGAAGGGTGGGGGCAGCTGG - Intergenic
934993942 2:98940030-98940052 AAATGAGCAGTTGGAGCAGAAGG - Intergenic
935591044 2:104845430-104845452 AAGAGAGGAGATGGGGCAGCAGG - Intergenic
935606189 2:104974319-104974341 CAGTGAGGAGCTGGAGCAGGTGG - Intergenic
935677017 2:105603545-105603567 AATTGAGGGGCTGGGGCAGGAGG - Intergenic
935792745 2:106608898-106608920 CAGTGAGTAGTTGGGACTGCAGG + Intergenic
936039952 2:109142242-109142264 GGGTGGGGAGGTGGGGCAGCTGG - Intronic
936523529 2:113227385-113227407 AGATGAGGAGTGGGGGCAGGAGG - Intronic
937431565 2:121843098-121843120 AAGAGAGGAGTGGAGGCAGTGGG - Intergenic
937469590 2:122163808-122163830 AAGTGAGAAGCTGGGTTAGCAGG + Intergenic
937497267 2:122434197-122434219 AAATGAGGAGATGGGCCATCAGG + Intergenic
938380190 2:130832136-130832158 AAGGGAGGAGGTGGGGGAGGAGG - Intergenic
939553328 2:143642864-143642886 AAGTGAGGAATTGGGGTTGAAGG + Intronic
941251702 2:163173242-163173264 AAGGGAACTGTTGGGGCAGCTGG - Intergenic
942204578 2:173607452-173607474 AAGAGAGTAGTTGGGGTAGAGGG + Intergenic
942248505 2:174028223-174028245 ATGTGAGGGGTGAGGGCAGCAGG - Intergenic
944867417 2:203876103-203876125 AATTGAGGAGTTGGGGAACTAGG + Intergenic
944980542 2:205114551-205114573 AAGTGAGAAGTTAGGAGAGCTGG - Intronic
946249708 2:218404902-218404924 AAGGGAGGAGGTGGGGCAGGGGG - Exonic
946396202 2:219444897-219444919 AAGTGAGCTGGTGGGGCAGCGGG + Exonic
948018109 2:234706573-234706595 AAGTGGGGTGTTGGGGTAGGGGG + Intergenic
948773110 2:240262360-240262382 AAGAGAGGATTTAGGGCAACTGG + Intergenic
948869903 2:240792533-240792555 GGGTGAGGAGTGGGGGGAGCTGG + Intronic
1169145654 20:3250553-3250575 AGGAGAGGAGTTGGGACAGTGGG + Exonic
1170286679 20:14717675-14717697 AAGTGAGGATTTGGGGAGGTGGG + Intronic
1170567298 20:17614467-17614489 AAGTGAGGACCTGGGCCAGCAGG + Intronic
1171105746 20:22430773-22430795 AAGAGAGAAGTAGGGGCAGTTGG + Intergenic
1171257827 20:23704194-23704216 ACGTGAGGAGTAGGAGCAGGAGG + Intergenic
1171267241 20:23781803-23781825 AGGTGAGGAGTAGGAGCAGGCGG + Intergenic
1171274906 20:23848205-23848227 AGGTGAGGAGTAGGAGCAGGAGG + Intergenic
1171284171 20:23924030-23924052 AGATGAGGAGATGGGTCAGCTGG + Intergenic
1171358031 20:24565729-24565751 AAGGTGGGAGTTGGGGCTGCTGG - Intronic
1173366671 20:42392038-42392060 AAGGGAGGGCTTGGGGCAGGTGG - Intronic
1173757022 20:45525542-45525564 AAGAGAGGGATTGGGGCTGCTGG + Intergenic
1173897633 20:46562947-46562969 AAGGGAGGAGCTGGTTCAGCAGG + Intronic
1173922951 20:46759491-46759513 AAGGGGGGAGCAGGGGCAGCAGG - Intergenic
1174239331 20:49120287-49120309 TAGTCAGGAGTTTGGGAAGCTGG + Intronic
1176025223 20:62982237-62982259 TGGGGAGGGGTTGGGGCAGCTGG - Intergenic
1176059401 20:63165781-63165803 AATGGAGGATTCGGGGCAGCAGG - Intergenic
1176108383 20:63400002-63400024 GAGTGAGGAGCAGGGGCGGCTGG - Intergenic
1176292421 21:5053106-5053128 AAGAGAGAGGTTGGGGGAGCAGG + Intergenic
1178356446 21:31913564-31913586 CAGAGAGGAGTTGGGGCCGGGGG + Intronic
1178641760 21:34350289-34350311 TGGTGAGGATTTGGAGCAGCTGG + Intergenic
1179078352 21:38145125-38145147 TGGTGAGGATGTGGGGCAGCAGG - Intronic
1179864836 21:44210544-44210566 AAGAGAGAGGTTGGGGGAGCAGG - Intergenic
1179954634 21:44731675-44731697 AACTGATGAATGGGGGCAGCTGG - Intergenic
1180874382 22:19168378-19168400 AGGTGAGTAGGTGGGGCCGCGGG - Intergenic
1181470766 22:23137957-23137979 TAGTTAGGTGTTGGGGCAACAGG - Intronic
1182186836 22:28412785-28412807 AAGGGAGGAAATGGGGCAGGTGG + Intronic
1182358985 22:29735611-29735633 AAGTGAGGGCTAAGGGCAGCAGG + Intronic
1182500241 22:30741371-30741393 TAGTGAGCACTTGGGACAGCGGG + Intronic
1183192514 22:36330895-36330917 AAGAGAGGGGCTGGGGCAGTGGG - Intronic
1183606954 22:38871671-38871693 AAGTGAGTTGTTGGGGAAGCTGG - Exonic
1183932499 22:41243978-41244000 TGGTGAGGATTTGGGGCAACTGG - Intergenic
1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG + Intronic
1184797598 22:46740984-46741006 AAGTGAGGCCCTGTGGCAGCCGG - Intergenic
949259470 3:2088780-2088802 AAGAGAGGGGTTGGGGGATCAGG - Intergenic
949635621 3:5978605-5978627 TATTGAGGAGGTGGGGCAGGGGG + Intergenic
949853078 3:8438465-8438487 AAGTGAGGACATGGGGAAGAAGG + Intergenic
949948415 3:9208531-9208553 AAGAAAAGAGTTTGGGCAGCAGG + Intronic
950078446 3:10204317-10204339 AATAAAGGAGATGGGGCAGCTGG + Intronic
950581637 3:13866120-13866142 CAGAGAGGAGTTGGGGCAGGGGG + Intronic
950676072 3:14555225-14555247 ACGTGGGGAGTTGGGACAGGGGG - Intergenic
951060378 3:18199959-18199981 AAGTGAGTATTTGTGGTAGCAGG + Intronic
951514734 3:23546001-23546023 AAGAGAGGAGGTGGGGCAGTTGG + Intronic
952140825 3:30477212-30477234 AAATTGGGAGTTGGGGGAGCAGG + Intergenic
952822771 3:37499208-37499230 AAGAGAGGATTTGGACCAGCTGG + Intronic
953411023 3:42690583-42690605 AGGAGAGGAGTAGGGGCAGTGGG + Intronic
953684795 3:45068322-45068344 ATGGTAGGAGTTGGGGCAGGAGG + Intergenic
953980364 3:47410379-47410401 AATTGAGGAGGTGGGGCCGAGGG - Exonic
955665102 3:61341967-61341989 TAGTGATGAGTTGGAGCAGATGG + Intergenic
957254838 3:77823950-77823972 ACGTGAGTATTTGTGGCAGCAGG + Intergenic
957572091 3:81959891-81959913 AAGTGGAGAGTTGGGGTAGAGGG + Intergenic
958427740 3:93998662-93998684 AAGGTAGTAATTGGGGCAGCTGG - Intronic
960459652 3:117917856-117917878 AAGTGAGGAAGTGAGGGAGCAGG - Intergenic
960949902 3:122992598-122992620 GGGTGAGGAGGTGGGGCATCAGG - Intronic
961088205 3:124088334-124088356 ATCAGATGAGTTGGGGCAGCTGG + Intronic
961346036 3:126263955-126263977 AAGGGAGGAGGAGAGGCAGCTGG + Intergenic
963216366 3:142753115-142753137 AAGTGTGTAGTTGAAGCAGCGGG + Intronic
965442920 3:168738542-168738564 AAGTGAGGGGTTAGAGAAGCAGG + Intergenic
965820546 3:172680392-172680414 AAGTGAGTAGTAGGGGGAGGGGG - Intronic
966462682 3:180194945-180194967 AAGCATGGAGTTGGGGCAGGTGG + Intergenic
968058751 3:195712747-195712769 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058767 3:195712807-195712829 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058776 3:195712836-195712858 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058785 3:195712865-195712887 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058793 3:195712894-195712916 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058801 3:195712923-195712945 CAGGGAGGAGTTAGGGCAGTAGG - Intergenic
968058809 3:195712952-195712974 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058834 3:195713043-195713065 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058842 3:195713072-195713094 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058868 3:195713161-195713183 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058877 3:195713190-195713212 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058895 3:195713248-195713270 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058922 3:195713335-195713357 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058947 3:195713422-195713444 CAGGGAGGAGTTAGGGCAGTAGG - Intergenic
968058955 3:195713451-195713473 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058980 3:195713542-195713564 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058988 3:195713571-195713593 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968058997 3:195713600-195713622 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968059015 3:195713660-195713682 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968059024 3:195713689-195713711 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968059041 3:195713749-195713771 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968059050 3:195713778-195713800 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968059058 3:195713807-195713829 CAGGGAGGAGTTAGGGCAGGGGG - Intergenic
968059068 3:195713836-195713858 CAGGGAGGAGTTAGGGCAGGGGG - Intergenic
968059088 3:195713894-195713916 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968059148 3:195714105-195714127 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968059234 3:195714409-195714431 CAGGGAGGAGTTAGGGCAGGAGG - Intergenic
968446409 4:654413-654435 ACGTGGGGAGATGGGGCAGCAGG - Intronic
968726884 4:2251964-2251986 CAGGGTGGGGTTGGGGCAGCGGG - Intronic
968784018 4:2605279-2605301 GAGTGAGGACTAGGAGCAGCCGG - Intronic
968959793 4:3737671-3737693 AAGTGAGGAATTGGGGGTGAGGG + Intergenic
969496414 4:7528929-7528951 AAGTGAGGTGATGTGGCCGCAGG - Intronic
969526939 4:7708613-7708635 GAGGGAGGACTTGGGGCAGAGGG - Intronic
969808434 4:9628724-9628746 CACAGAGGAGTTGGGGCATCGGG - Intergenic
971376374 4:26058937-26058959 AGGTGAGTAGTTGGTCCAGCAGG - Intergenic
972621314 4:40750303-40750325 AAGGGAGGAGTCGGGGGAGCCGG + Intronic
974585618 4:63872650-63872672 ATTTGAGAAGCTGGGGCAGCAGG - Intergenic
975654231 4:76625434-76625456 AAGTGAGGGGTTGAGGGAGAGGG - Intronic
976053806 4:81039240-81039262 AAGAAAGAAGTTGGGGCAGCGGG + Intronic
976540367 4:86267477-86267499 AATGGAGGATTTGGGGCAGAGGG - Intronic
977890712 4:102308236-102308258 AAGTGAGCACATGGGGCAGGAGG + Intronic
978827956 4:113047552-113047574 GAGTGAGGGGTTGGGAGAGCAGG + Intronic
982139923 4:152307561-152307583 AACTGAGGAGCTGGAGAAGCAGG + Intergenic
983528872 4:168789277-168789299 ATGGGAAGAGTTGGGGCAGGAGG + Intronic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985285946 4:188336554-188336576 AAGTGTGGAGTTGGGGGGCCGGG - Intergenic
985767741 5:1788947-1788969 ATGAGAGGAGTAGGGGCAGCGGG + Intergenic
985893358 5:2733466-2733488 AAGGGAGGCTTTGGGGCAGGAGG + Intergenic
987231090 5:15894146-15894168 AAGTGAGTAGCTGGGACAACAGG - Intronic
987733337 5:21806110-21806132 AAGGGAGGAATTGGGGAAGGGGG + Intronic
988444527 5:31270803-31270825 TAGTTGGGAGTTGGGGCAGGAGG - Intronic
989822470 5:45810597-45810619 CAGTGAGGATATGTGGCAGCAGG + Intergenic
990347545 5:54884467-54884489 AAGTCAAGAGTGAGGGCAGCAGG + Intergenic
991254988 5:64603757-64603779 AGATGATGAGCTGGGGCAGCCGG + Intronic
991281821 5:64923171-64923193 AAGTGCTGAGGTGGGGCAGTGGG + Intronic
991613777 5:68475218-68475240 AATTGAGGAGGTGGAGCAGAGGG - Intergenic
992457274 5:76927386-76927408 ATGTGAGGATCTGGGGCAGAGGG - Intergenic
992485385 5:77189675-77189697 AAGTGAGCAGGAGGGGCAGCAGG + Intergenic
993993489 5:94689251-94689273 TAGTGAGCAGTTGGGGGAGTAGG + Intronic
997208630 5:132064988-132065010 AAGTGAGGGCTGGGGGGAGCTGG - Intergenic
997691497 5:135830480-135830502 AAGTGAGGGGGTGAAGCAGCTGG - Intergenic
999370450 5:151052118-151052140 GGGTGAGGAGTGGGGGCTGCAGG - Intronic
999428620 5:151507529-151507551 AAGGGGGGACTGGGGGCAGCAGG - Exonic
999616799 5:153433485-153433507 AAGTGAGGAGGTGGGGTAGAGGG - Intergenic
999618313 5:153449018-153449040 ATATGAGGAGTTGGGGGAGAGGG + Intergenic
999809376 5:155113457-155113479 AACTGAGCAGATGGGGCACCGGG - Intergenic
1001020623 5:168179437-168179459 AAGCTAGGAGCTGGGGCAGAGGG + Intronic
1001264755 5:170265802-170265824 AAGAAAGGGGTGGGGGCAGCTGG + Intronic
1002045434 5:176538898-176538920 AAGGGAGAAGTTGGGTCAGTAGG + Intergenic
1002320406 5:178372138-178372160 AAATAAGGTGATGGGGCAGCAGG + Intronic
1002464379 5:179398933-179398955 AAATAAGGAGTTGGAGCAGATGG - Intergenic
1002575000 5:180169587-180169609 ACGTGAGCAGTGGGGGCAGGGGG + Intronic
1003034189 6:2628711-2628733 TGGTAAGGAGTTGGGGCTGCAGG + Intronic
1003652704 6:7976029-7976051 GAGTGAGGTGTTGGTGCACCTGG - Intronic
1004693442 6:18012188-18012210 CAGTGGGGAGTGGGGGGAGCTGG - Intergenic
1005599463 6:27411860-27411882 AAGTGAGGAGGGAGGGCGGCTGG - Intergenic
1005860730 6:29897816-29897838 GAAGGAGGAGTTGGGGCAGATGG + Intergenic
1006132619 6:31878331-31878353 CTGTGAGGAGTTGGGGCTGAGGG - Intronic
1007062323 6:38952984-38953006 AAGTGAGGCTTAGAGGCAGCTGG - Intronic
1010335919 6:74683540-74683562 AGGTGGGAAGTTGGGGCACCTGG - Intergenic
1013135031 6:107273925-107273947 ATGAGGGGAGTTGGGGCAGCCGG + Intronic
1013355325 6:109341357-109341379 AAGTGAGGAGCCTGGGCCGCTGG + Intergenic
1015726864 6:136308100-136308122 AAGCGGGGAGTGGGGGCAGAGGG - Intergenic
1017091311 6:150761876-150761898 TAGTGAGGAGATGGGCCAGCTGG - Intronic
1018122315 6:160647286-160647308 AGCTGAGGAGTTTGGGCTGCGGG + Intronic
1018253657 6:161896627-161896649 ACGGGAGGAGCTGGGGGAGCAGG + Intronic
1019346058 7:531385-531407 AAGTGAGGTGTGGGGGCAAATGG + Intergenic
1019666122 7:2253014-2253036 AGGGCAGGAGTTGGGGGAGCAGG - Exonic
1019867551 7:3726819-3726841 AAGAGAAGAGTTGGGGGAGTTGG - Intronic
1021225944 7:18026404-18026426 AAGTGGGGGTTTGGGGCAGGGGG + Intergenic
1023073063 7:36456880-36456902 AAGTGGGGAGTTAGCACAGCTGG - Intergenic
1023917521 7:44601216-44601238 AGGTGAAGAGTTTGGGCATCTGG + Intergenic
1023986936 7:45102260-45102282 AGGTGAGAATTTGGGGCAGATGG - Intronic
1026274476 7:68864592-68864614 ATCTCAGGAGTTGGGCCAGCAGG + Intergenic
1026853454 7:73738566-73738588 AAGGGAGGAGATGGGGCCGTCGG + Intronic
1026942501 7:74295336-74295358 AGTTGAGAAGCTGGGGCAGCAGG + Intronic
1027233482 7:76284845-76284867 GAGTGAGGAGTGGGGCCGGCGGG + Intronic
1027694111 7:81387339-81387361 AAATGAAGAGTTGGGGAAGAGGG - Intergenic
1028388034 7:90281521-90281543 AAGGGTGGTGTTGGGGCAGTTGG + Intronic
1029035804 7:97520127-97520149 AATTAAGAAATTGGGGCAGCCGG - Intergenic
1029316220 7:99716996-99717018 CGATGAGGAGGTGGGGCAGCTGG - Intronic
1029321880 7:99769587-99769609 CGATGAGGAGGTGGGGCAGCTGG - Intronic
1029797823 7:102913669-102913691 GAGTGAGGATTTGGGACAGAAGG + Intronic
1030186564 7:106768193-106768215 AAGTGAGGAATAGGAACAGCTGG - Intergenic
1031995470 7:128227577-128227599 AATTGGGGAGTGGGGGCAGGGGG - Intergenic
1034223428 7:149462366-149462388 CAGTGAGCAGTTCGGGAAGCCGG - Intergenic
1034469940 7:151249676-151249698 CCCAGAGGAGTTGGGGCAGCTGG + Intronic
1034698486 7:153076037-153076059 AAGCCAGGAGAGGGGGCAGCTGG + Intergenic
1034919994 7:155071703-155071725 AAGTGTGGGGGTGGGGCAGGTGG - Intronic
1035153864 7:156896547-156896569 AAGTGAGGAAGTGGGGAAGAGGG + Intergenic
1035522080 8:283218-283240 CAGGGAGGTGTTGGGGCAACAGG - Intergenic
1036138956 8:6188741-6188763 AAGTGAGAGGTTGAGGCAGGAGG - Intergenic
1036224089 8:6943632-6943654 AAGTGAGGTGTAGGTGCAGGCGG + Intergenic
1036431868 8:8699320-8699342 ATGTGAGGAGATGAGGCGGCAGG + Intergenic
1036750112 8:11438323-11438345 AGCTGATGAGTTGGGGCTGCTGG - Intronic
1039288711 8:36070610-36070632 TATGGAGGAGTTGGGGCAGAGGG + Intergenic
1039522392 8:38181977-38181999 AAGTTTGGAGTTGGAGCAGAGGG + Intronic
1040342655 8:46448732-46448754 AAGGGTGGAGTTGGGGCCGCAGG - Intergenic
1040543497 8:48379964-48379986 AAGTGTGGGGCTGGGGCAGGCGG - Intergenic
1041143660 8:54848201-54848223 GAGTGAGGAGCTGAGGCAGCAGG + Intergenic
1041797786 8:61763773-61763795 AAGGGAGGAGTGTGGACAGCAGG - Intergenic
1043539508 8:81243700-81243722 AAGTGAGAAGACGAGGCAGCTGG + Intergenic
1044229072 8:89754622-89754644 GAGTGAGGATTTGGAGCAACAGG - Intergenic
1044744711 8:95361152-95361174 AAGGGAGGAGCAGGAGCAGCAGG + Intergenic
1045280081 8:100742542-100742564 AATTAAGGAGATGGGGAAGCGGG + Intergenic
1046689361 8:117265750-117265772 AAGAGAGGAGTTGGGGCAGCTGG + Intergenic
1047348095 8:124048060-124048082 ATGGGTGGAGTTAGGGCAGCTGG - Intronic
1047698423 8:127426801-127426823 AAGGGAGGAGCTGGGGGAGGAGG - Intergenic
1047749983 8:127873084-127873106 AGGTGAGGATATGGGGCAGAAGG + Intergenic
1048783370 8:138024962-138024984 AGCTGAGGAGTTGGGGCATAGGG - Intergenic
1049187832 8:141267819-141267841 AGGTGAGGATGTGGGGCAGCAGG + Intronic
1049445191 8:142626985-142627007 GGGTGAGGAGATGGGGCTGCAGG - Intergenic
1049692731 8:143969716-143969738 GAGTGGGGAGTGGGGCCAGCCGG + Intronic
1051339986 9:16102265-16102287 AACTGAGATGTTGGGGCTGCAGG - Intergenic
1051394797 9:16608208-16608230 AAGTGAGGAATTGGGGTCTCAGG - Intronic
1051609934 9:18951268-18951290 AGGGGAGGACCTGGGGCAGCTGG - Intronic
1052325695 9:27214969-27214991 GAGGGAGGAGTTGGGAAAGCTGG - Intronic
1053391110 9:37736947-37736969 AAGTGAGGATATGGGGCACCAGG + Intronic
1053524902 9:38818673-38818695 AGGTGAGGAGTTGGTGAAGTGGG - Intergenic
1054197134 9:62043089-62043111 AGGTGAGGAGTTGGTGAAGTGGG - Intergenic
1054641274 9:67545605-67545627 AGGTGAGGAGTTGGTGAAGTGGG + Intergenic
1055758752 9:79583561-79583583 AAGTGAGAGGTTGGGGAAGGAGG + Intronic
1055874305 9:80923799-80923821 GAGTGAGCAGGTGGGACAGCAGG + Intergenic
1056686883 9:88773895-88773917 ATGTGAAGAATTGAGGCAGCGGG - Intergenic
1056895621 9:90545934-90545956 AAGTTAGGATTTAGGGCAGAAGG - Intergenic
1057261338 9:93586509-93586531 ATGGGAGGAGTGGGGGCTGCTGG - Intronic
1057809756 9:98248726-98248748 ATGTAAAGTGTTGGGGCAGCAGG + Intronic
1057939928 9:99273064-99273086 AAGTGAGAAAATGGGGCAGCAGG - Intergenic
1058189255 9:101892743-101892765 AGGAAAGGGGTTGGGGCAGCAGG + Intergenic
1059471090 9:114505268-114505290 AAGTCAGAAGTTGGGGCGGAGGG + Intronic
1060005172 9:119993213-119993235 AAGTGAGGGGATAGGGCAGAGGG + Intergenic
1060053197 9:120391587-120391609 AAATGAGGACCTGAGGCAGCTGG + Intronic
1061643707 9:131981689-131981711 AAGCCAGGAGATGGGGCAGGAGG + Intronic
1061862860 9:133476822-133476844 AAGTCCAGAGTGGGGGCAGCTGG + Intronic
1062052827 9:134456307-134456329 ACGTCAGCAGCTGGGGCAGCAGG - Intergenic
1186624002 X:11272478-11272500 AAATGAGGAGTGGAGGCAGGAGG - Intronic
1187187949 X:17005453-17005475 AAGGGAGGAGGTGGGGCACATGG - Intronic
1187259221 X:17669839-17669861 AAGTGAGGATTTGGGGCTTTGGG - Intronic
1188062983 X:25623894-25623916 AAGTAAGGGGTTGGGGGAGTGGG - Intergenic
1188974853 X:36660888-36660910 AAGTGAAGAGTTGGGCAAGGAGG - Intergenic
1191069464 X:56384432-56384454 AAGTGAGGAGTCGGGTGAGGGGG + Intergenic
1191171136 X:57448096-57448118 AACTTAGGAGTTGAGGCAGGAGG - Intronic
1192283065 X:69704587-69704609 AGGTGAGGAGTGGGGGGAGTGGG + Intronic
1193515119 X:82452742-82452764 AAGAGAGGAATTGGGGCCTCTGG - Intergenic
1195654306 X:107320456-107320478 GAGTGAGGAGACTGGGCAGCTGG + Intergenic
1195668169 X:107449230-107449252 AACTGCGGAGAAGGGGCAGCAGG - Intergenic
1199605806 X:149578847-149578869 AAGTGAGTGGTTGGGCAAGCAGG + Intergenic
1199633315 X:149790521-149790543 AAGTGAGTGGTTGGGCAAGCAGG - Intergenic
1200110080 X:153736571-153736593 ATAGGAGGAGCTGGGGCAGCAGG - Intronic