ID: 1184101036

View in Genome Browser
Species Human (GRCh38)
Location 22:42341899-42341921
Sequence AGTCTGGGAGGACCACAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 324}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184101023_1184101036 22 Left 1184101023 22:42341854-42341876 CCATGGAAAAAGGCCTTCACTTC 0: 1
1: 0
2: 1
3: 37
4: 308
Right 1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG 0: 1
1: 0
2: 2
3: 47
4: 324
1184101030_1184101036 -6 Left 1184101030 22:42341882-42341904 CCTGAGAAGGAGATGGGAGTCTG No data
Right 1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG 0: 1
1: 0
2: 2
3: 47
4: 324
1184101029_1184101036 -3 Left 1184101029 22:42341879-42341901 CCACCTGAGAAGGAGATGGGAGT No data
Right 1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG 0: 1
1: 0
2: 2
3: 47
4: 324
1184101024_1184101036 9 Left 1184101024 22:42341867-42341889 CCTTCACTTCACCCACCTGAGAA 0: 1
1: 1
2: 2
3: 53
4: 355
Right 1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG 0: 1
1: 0
2: 2
3: 47
4: 324
1184101028_1184101036 -2 Left 1184101028 22:42341878-42341900 CCCACCTGAGAAGGAGATGGGAG 0: 1
1: 0
2: 1
3: 19
4: 276
Right 1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG 0: 1
1: 0
2: 2
3: 47
4: 324
1184101022_1184101036 23 Left 1184101022 22:42341853-42341875 CCCATGGAAAAAGGCCTTCACTT 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG 0: 1
1: 0
2: 2
3: 47
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184101036 Original CRISPR AGTCTGGGAGGACCACAGGG AGG Intronic
900183599 1:1323025-1323047 AGGCTGGGAGGACCCCACGGAGG + Exonic
901324685 1:8359426-8359448 AGTCGGGGAGAAGCACAAGGGGG - Intronic
901353534 1:8621181-8621203 AGTCTGGCAGGACAACAGACAGG + Intronic
902067328 1:13699519-13699541 AGTCGGGGAGAAGCACAGGCTGG - Intergenic
902910871 1:19596492-19596514 AGCCAGGGAGGATCAGAGGGAGG + Intergenic
903168065 1:21534925-21534947 AGGCAGGGAGGAGGACAGGGAGG - Intronic
903480884 1:23652467-23652489 AGTCCGGGAGGACTGAAGGGAGG + Intergenic
904357736 1:29951931-29951953 AGGCTGGAATGCCCACAGGGGGG + Intergenic
905207247 1:36349907-36349929 AAGCTGGGAGGACAACAGGAAGG + Intronic
906508918 1:46400234-46400256 AGTCTGAGAGGACCACAGCTTGG + Intronic
906791153 1:48659706-48659728 AGTCTGGGAGGCCCACACCTGGG + Intronic
909044964 1:70698812-70698834 ACTTTGGGAGGACCAAAGGAGGG - Intergenic
910209437 1:84778190-84778212 AGTCTGGGAAGCACACAGGGTGG + Intergenic
910348048 1:86263563-86263585 AGTCAGAGAGGACCATGGGGTGG + Intergenic
913532429 1:119742544-119742566 AGGCTTGGAGGAAAACAGGGAGG - Intronic
913586048 1:120276950-120276972 AGTGTGGGAGGATGACAGAGAGG - Intergenic
913622137 1:120621419-120621441 AGTGTGGGAGGATGACAGAGAGG + Intergenic
914568056 1:148888808-148888830 AGTGTGGGAGGATGACAGAGAGG - Intronic
914604768 1:149241440-149241462 AGTGTGGGAGGATGACAGAGAGG + Intergenic
915475220 1:156149248-156149270 ATTCGGGGAGGAGCACAGGCAGG - Intronic
915901183 1:159847642-159847664 GGAGTGGGAGGTCCACAGGGAGG - Intronic
917055713 1:170978840-170978862 AGTCTGTGGGGACCAAAGGCTGG - Intronic
918118219 1:181515160-181515182 AGTGTGGGATGAGCTCAGGGAGG + Intronic
920301659 1:204992619-204992641 AGTCAGGGAGGCCCCCAGTGTGG - Intronic
920971525 1:210747249-210747271 AGTCTTAGAGAGCCACAGGGAGG + Intronic
922220880 1:223557644-223557666 AGTCTGGGAAGGCCCCATGGAGG - Intronic
923356464 1:233160802-233160824 TGTCTGGAAGGACCACAGCCAGG + Intronic
923549789 1:234954488-234954510 ATTCTGGAAGGACCACTGGCTGG - Intergenic
924208747 1:241743215-241743237 AGAGTGGGAGGACCACATGAAGG + Intronic
924911875 1:248522145-248522167 AGTGTGCGATGACCACAGAGGGG - Exonic
1062873770 10:930142-930164 AGTTTGTGAAGACCACAGTGGGG - Intronic
1064052063 10:12067972-12067994 ACTCTGGGAGGCCCTCTGGGAGG - Intergenic
1066562920 10:36689896-36689918 AGTCTGGCAGGAGGAGAGGGAGG - Intergenic
1067531147 10:47074515-47074537 AGTCTAGGAGCCCCACAAGGTGG - Intergenic
1067556526 10:47277045-47277067 AGTCTGAGAGGAACACAGTCAGG - Intergenic
1067655530 10:48188679-48188701 AGTCTGGGAGGAGCCGAGAGAGG + Intronic
1067684101 10:48456973-48456995 ATGCTGGGAGGCCCACAGGCTGG - Intronic
1067689585 10:48493283-48493305 AGACTGGGAGGACAGCAGGGAGG - Intronic
1068867546 10:61910557-61910579 AGTCAGTGAGGAACACAGCGTGG - Intronic
1069034088 10:63630109-63630131 AGTCTGGGAGGACGCGTGGGAGG - Intergenic
1069717290 10:70529404-70529426 AGTTGGGGAGGGCCAGAGGGAGG - Intronic
1069717620 10:70531100-70531122 TGACTGGGAGGGTCACAGGGAGG + Intronic
1069922028 10:71821522-71821544 AGTCTGTCAGGGCCACAGGATGG + Intronic
1070669543 10:78368398-78368420 CCTCTTGGAGGACCACAGGGGGG + Intergenic
1072616929 10:97056323-97056345 AGTCTGGATGGCCCGCAGGGAGG + Exonic
1073077091 10:100830918-100830940 AGTGTGGGAGGACCAGAGCTGGG - Intergenic
1075736927 10:124669860-124669882 GGTGGGTGAGGACCACAGGGTGG + Intronic
1076129586 10:128003944-128003966 CGTCTGCCAGGACCACAGAGAGG + Intronic
1076132775 10:128025572-128025594 GGTCTGGGAGGAGCTCAGGATGG - Intronic
1076420693 10:130329782-130329804 CGTCTGGGAAGACGAAAGGGCGG - Intergenic
1077337434 11:2011699-2011721 AGTGAGGGAGGACCACACGGGGG + Intergenic
1077458967 11:2699429-2699451 AGTCTGGGAGAACCGCACTGAGG + Intronic
1081775603 11:45674250-45674272 AGTCAGGGAGGAGCCCAGGAGGG - Intergenic
1081996047 11:47364719-47364741 AGGCTGGGACCACCACAGTGAGG - Intronic
1082260400 11:50073233-50073255 GGTCTGTGAAGGCCACAGGGAGG + Intergenic
1083731230 11:64653720-64653742 AGTCTGGGGGGGCCATGGGGCGG + Exonic
1083861585 11:65422955-65422977 GGTCTAGGGGGACCACAGTGGGG + Intergenic
1083903501 11:65655187-65655209 AGTCAGGGAGGACTCCAAGGTGG - Intronic
1083928084 11:65821280-65821302 AGTCTCTGAGGACCAGAGGAAGG + Intergenic
1083978072 11:66140441-66140463 AGTCTGGGAGGTCCACGGTTGGG - Intronic
1085689032 11:78650843-78650865 AGTCTGGAATAACCCCAGGGTGG - Intergenic
1085917167 11:80903532-80903554 AGTAGGGAAGGACCACTGGGTGG - Intergenic
1089498529 11:118919680-118919702 GGTCTGGGAGGAACACAGGCTGG - Intronic
1091030482 11:132183014-132183036 AGTGTGACAGGAACACAGGGAGG - Intronic
1091308834 11:134558795-134558817 ATGCTGGGAGGAACACAGGAAGG + Intergenic
1202820418 11_KI270721v1_random:66881-66903 AGTGAGGGAGGACCACACGGGGG + Intergenic
1091683953 12:2548299-2548321 GCTCTGGGAGCACCACAGGAGGG - Intronic
1092070027 12:5624707-5624729 AGACTGGGAGCTCCACACGGCGG - Intronic
1092070583 12:5628253-5628275 AGGCAGGGAGGACAGCAGGGAGG - Intronic
1092217621 12:6694124-6694146 AGTTAGGGAGGCCCAAAGGGAGG + Exonic
1092602622 12:10083070-10083092 AGCCTGGTAGCACCACTGGGTGG + Intronic
1095952894 12:47791186-47791208 GGCCTGGGAGAACCACAGGGAGG + Intronic
1097178902 12:57159748-57159770 AGTCCGGGAGGGCCAGAGGCAGG + Intronic
1097745927 12:63302924-63302946 AGTCTGGGAAAAGCAGAGGGAGG + Intergenic
1098646767 12:72911509-72911531 AGGCTGGGGAGACCTCAGGGAGG - Intergenic
1102236303 12:111296624-111296646 TGTCTGGGAGGGTCAGAGGGAGG - Intronic
1102236319 12:111296680-111296702 TGTCTGGGATGGCCAGAGGGTGG - Intronic
1102236327 12:111296708-111296730 TCTCTGGGAGGGCCAGAGGGTGG - Intronic
1102236344 12:111296764-111296786 TGTCTGGGATGGCCAGAGGGTGG - Intronic
1102236352 12:111296792-111296814 TCTCTGGGAGGGCCAGAGGGTGG - Intronic
1102236369 12:111296848-111296870 TGTCTGGGATGGCCAGAGGGTGG - Intronic
1102236377 12:111296876-111296898 TCTCTGGGAGGGCCAGAGGGTGG - Intronic
1102236444 12:111297124-111297146 TGTCTGGGAGGGCCAGAGGGTGG - Intronic
1102236466 12:111297208-111297230 TGTCTGGGATGATCAGAGGGAGG - Intronic
1102457018 12:113077289-113077311 AGTCTGGGTGGACCCCCTGGAGG + Intronic
1102573674 12:113842935-113842957 AGTCTGGGAAGACCACAGTGTGG + Intronic
1104292918 12:127485652-127485674 AGTATGGGAGCCCCAAAGGGTGG + Intergenic
1104788180 12:131464718-131464740 AGTCTGGAAGGACTACACCGTGG + Intergenic
1106060032 13:26281344-26281366 AGTCTGGTAGCCCCACGGGGTGG + Intronic
1109504964 13:63287789-63287811 AGTCTGGTAGCCCCACTGGGTGG - Intergenic
1110232229 13:73179017-73179039 AGCCTGGGAGGTCAACAGTGCGG - Intergenic
1110405789 13:75149085-75149107 GATTTGGGAAGACCACAGGGTGG - Intergenic
1112026818 13:95419002-95419024 AGACTGGAAGGAACAGAGGGAGG - Intergenic
1112321605 13:98413010-98413032 AGTCTGGGATCACCAGAGGCAGG - Intronic
1113075736 13:106466484-106466506 AGACTGGGAGGATCAGAGGAGGG - Intergenic
1113395534 13:109944091-109944113 AGACTTGGAGGCCTACAGGGAGG + Intergenic
1114278544 14:21169494-21169516 AGTCTGTGGGGACCAGAGGCTGG + Intergenic
1114664471 14:24369678-24369700 AGGCTGGGAGGACCAGGAGGGGG + Exonic
1115845720 14:37531202-37531224 AGTCTGGCAGGAACAAAGAGAGG - Intronic
1117366977 14:55038774-55038796 AGTCTGGGTGGAGAACAGGGTGG - Intronic
1118251154 14:64162422-64162444 AGGCTGGGAGGACCAGGTGGTGG + Intronic
1118708479 14:68501239-68501261 AGTCTGGGAGGAGGCCAGAGGGG - Intronic
1119485314 14:74982886-74982908 AGTCAGGCAGGGCCACAGGAGGG + Intergenic
1119891874 14:78189008-78189030 AGTCTGGGAGGAGCAGATTGGGG - Intergenic
1121227034 14:92328657-92328679 AGTCTGGGAGGACATAAGGTTGG - Intronic
1121339431 14:93096398-93096420 AGTCTGTGAGGGCTATAGGGAGG - Intronic
1122087985 14:99320346-99320368 CTTCTGGGAGGGGCACAGGGTGG + Intergenic
1122141017 14:99663076-99663098 AGACCAGAAGGACCACAGGGTGG - Intronic
1202883861 14_KI270722v1_random:85814-85836 AGTCTAGGAGAACTGCAGGGCGG - Intergenic
1123634098 15:22285992-22286014 AGTCTGGCAGGACAACAGACAGG - Intergenic
1124512133 15:30336467-30336489 AGCCTGGGAGGTTCTCAGGGTGG + Intergenic
1124730781 15:32194284-32194306 AGCCTGGGAGGTTCTCAGGGTGG - Intergenic
1126610298 15:50522179-50522201 AGTCTGGGAGGCCAAGTGGGTGG + Intronic
1128073600 15:64812480-64812502 CCTCTGGGAGCACCACAGGGAGG + Intergenic
1128252460 15:66172659-66172681 AGTATGGGGGAAACACAGGGTGG - Intronic
1129741961 15:77993628-77993650 GGTCTCTGAGGACCACAGAGTGG - Intronic
1129843744 15:78758842-78758864 GGTCTCTGAGGACCACAGAGTGG + Intergenic
1130258061 15:82334958-82334980 GGTCTCTGAGGACCACAGAGTGG - Intergenic
1130596871 15:85255005-85255027 GGTCTCTGAGGACCACAGAGAGG + Intergenic
1130609198 15:85345286-85345308 GGTCTGGGAGGAGGAGAGGGTGG - Intergenic
1130994960 15:88898596-88898618 GCTCAGGGAGGACCACAGGTGGG + Intergenic
1132826084 16:1906380-1906402 AAGCTGGGGGGACCACACGGAGG - Intergenic
1133327014 16:4947955-4947977 AGTCTGGGAGGAATTCGGGGAGG + Intronic
1133999006 16:10768125-10768147 GGTCTGTGATGACCACAGAGTGG + Exonic
1134109089 16:11503544-11503566 AGCCTCGGAGGACCTCTGGGTGG - Intronic
1135148493 16:19984591-19984613 AGTCTGGGAGGACTTCACTGGGG + Intergenic
1136051642 16:27654831-27654853 AGTCTAGGAAAACCACAGGGCGG + Intronic
1136139796 16:28281396-28281418 ACTCGGGGAGGGACACAGGGTGG - Intergenic
1137708572 16:50551109-50551131 AGTCTGGGAGGATGGGAGGGAGG + Intronic
1138453578 16:57107806-57107828 AGTCTGGCAGGAACACAATGAGG - Intronic
1139118936 16:63991703-63991725 AGCCTGGGTGGACAACAGCGAGG + Intergenic
1140112884 16:72018598-72018620 AGACCAGGAGGGCCACAGGGAGG - Intronic
1140267483 16:73433260-73433282 AGTCTGGGAGAACAAGGGGGTGG - Intergenic
1141473855 16:84258702-84258724 GGTCTGTGTGGACCAAAGGGAGG - Intergenic
1141765104 16:86052966-86052988 AGGCTGGGAGGGGCAGAGGGAGG + Intergenic
1142775479 17:2134837-2134859 GGTCTGGGATGATGACAGGGAGG - Intronic
1143407927 17:6690393-6690415 AGACTGGGAGCACCACTGGCTGG - Intronic
1143947114 17:10603198-10603220 AGTGTGGCAGGAACACAGTGGGG + Intergenic
1144101948 17:11949239-11949261 ACTCTGGGAGAACTACAGGCTGG - Intronic
1144370096 17:14582118-14582140 AGTTTGGAAGGACCTCAGGCAGG + Intergenic
1144676081 17:17162574-17162596 TGGCAGGGAGGCCCACAGGGAGG - Intronic
1145284698 17:21496484-21496506 AGGCTGAGCGCACCACAGGGAGG - Intergenic
1145911161 17:28543987-28544009 TGCCTGGGAGGAAGACAGGGTGG - Intronic
1146227623 17:31080348-31080370 TGTTTGGGAGGACTAGAGGGAGG + Intergenic
1147605176 17:41770341-41770363 GGTCTGGGAGTCCCACAGGTAGG + Intronic
1147739770 17:42664708-42664730 GCTCTGGGAAGACCACAGAGAGG - Intronic
1147773070 17:42880832-42880854 AGTCTGGGAGGACTTCAGAGAGG + Intergenic
1148675512 17:49442533-49442555 AGTCTGGGGGGACTCTAGGGAGG + Intronic
1148744495 17:49910745-49910767 AGTCTGGGAGGGCCACCTGGAGG - Intergenic
1150414087 17:64973317-64973339 AGTCTTGGGGGGCCTCAGGGTGG + Intergenic
1151212727 17:72556941-72556963 AGTCTCGGAGGGGCACAGTGGGG - Intergenic
1152036406 17:77875777-77875799 AGTGTGGCAGGAACACAGAGGGG + Intergenic
1152205023 17:78970034-78970056 GGTCTGGGAGGACAACAGTGTGG - Intergenic
1153667019 18:7375381-7375403 AGGCTAGGAGGAGCACGGGGTGG + Intergenic
1154960889 18:21307674-21307696 TGTCTGTGAGGACCACAGTGAGG + Intronic
1157339611 18:46767895-46767917 AGGCTGGGAGGAGCACAGGGTGG - Intergenic
1157442501 18:47721555-47721577 AGACAGGGAGGAAGACAGGGAGG + Intergenic
1157754520 18:50206096-50206118 AGTCTGGGAGGCCGAGATGGCGG - Intergenic
1158499489 18:57987317-57987339 AGACTGGGAGGGGCAAAGGGAGG - Intergenic
1160673432 19:376972-376994 AGGCTGGGTGGGGCACAGGGGGG - Intergenic
1160673474 19:377076-377098 AGGCTGGGTGGGGCACAGGGGGG - Intergenic
1160673485 19:377101-377123 AGGCTGGGTGGGGCACAGGGGGG - Intergenic
1160673527 19:377205-377227 AGGCTGGGTGGGGCACAGGGGGG - Intergenic
1160673560 19:377284-377306 AGGCTGGGTGGGGCACAGGGGGG - Intergenic
1160673582 19:377336-377358 AGGCTGGGTGGGGCACAGGGGGG - Intergenic
1160673613 19:377413-377435 AGGCTGGGTGGGGCACAGGGGGG - Intergenic
1161118581 19:2512828-2512850 ACCCTGGGAGGACCCCAGGCAGG - Exonic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161268044 19:3374182-3374204 AGGGTGGGAGGAGCACAGGGAGG + Intronic
1161397330 19:4051789-4051811 AGCCTGGGAGGCCCAGAGAGAGG + Intronic
1163419290 19:17205243-17205265 ACACTAGGAGGTCCACAGGGTGG - Exonic
1165142271 19:33706889-33706911 ATTGTGGGAGGACCACAGGCCGG + Intronic
1166998308 19:46730318-46730340 AGACAGGGAGGACCCCAGAGTGG + Intronic
1167098663 19:47390468-47390490 AGGAGGGGAGGAGCACAGGGAGG - Intergenic
1167334247 19:48874791-48874813 AGCCTAGGAGGAGCCCAGGGAGG - Exonic
1167646573 19:50709011-50709033 AGCCTGGGAGGAAGACAAGGGGG + Intronic
1167719941 19:51172405-51172427 AGGCTGGAGGGATCACAGGGAGG - Intergenic
1167736960 19:51300683-51300705 AGTCCTGGAGGAACAAAGGGAGG + Intergenic
1167885004 19:52493177-52493199 AGCCTGGGAGGCGCCCAGGGCGG - Intronic
1167890578 19:52536363-52536385 AGGCTGGGAGGCGCCCAGGGCGG - Intronic
1167925973 19:52821248-52821270 AGGCTGGGAGGCGCACAGGGTGG + Intronic
1167930158 19:52857234-52857256 AGGCTGGGAGGCGCACAGGGTGG + Intronic
1167940449 19:52942205-52942227 AGACTGGGAGGCGCCCAGGGCGG + Intronic
1167967358 19:53158389-53158411 AGGCTGGGAGGCACCCAGGGCGG + Intronic
1167991697 19:53366075-53366097 AGGCTGGGAGGCGCCCAGGGCGG - Intronic
1167995086 19:53395509-53395531 AGACTGGGAGGCGCTCAGGGAGG - Intronic
1168274773 19:55271598-55271620 AGGCTGGGAGGAGAACAGGGAGG - Intronic
1168353804 19:55690257-55690279 AGCCTGGCATGGCCACAGGGAGG + Intronic
925089293 2:1140617-1140639 AGCCTGGCAGGGCCACAGCGAGG + Intronic
925210990 2:2045880-2045902 ACCCATGGAGGACCACAGGGAGG - Intronic
925838783 2:7970989-7971011 GGACTGAGAGGACCACAGGGTGG + Intergenic
927080020 2:19617933-19617955 AGACTGGTAGCCCCACAGGGTGG + Intergenic
927247949 2:20973192-20973214 AGCCTAGGAGGACCACTGGGAGG + Intergenic
927250464 2:20991368-20991390 AGACTGGGAGACTCACAGGGAGG + Intergenic
929023391 2:37576025-37576047 AGTCAGGGAGGACAGCAGGAAGG - Intergenic
929450658 2:42034920-42034942 CGTCTGGGAGGACAGAAGGGTGG + Intergenic
931462126 2:62458205-62458227 AGTCTGGGCGGATCCCAGGAAGG + Intergenic
932839855 2:75072071-75072093 AGTCTAGGGGGAGCACAGAGTGG + Intronic
934571092 2:95373884-95373906 AGTCAGGGAGGGCCACATGGAGG + Intronic
934852001 2:97707472-97707494 GCTCTGGGAGGGCCACATGGTGG - Intergenic
935056008 2:99567545-99567567 AGGCTGGGAAGGCCACAGGGAGG + Intronic
938388018 2:130881788-130881810 AGCCAGTGAGGACCACAGGCTGG + Intronic
938620829 2:133051182-133051204 AGTCTCTGAGGACCACACAGAGG - Intronic
939149587 2:138456869-138456891 AGTCTGGCAGCCCCACTGGGTGG + Intergenic
943701959 2:190996525-190996547 GGTCTAGGAGGACCACTAGGGGG + Intronic
944263681 2:197701200-197701222 AGTCTGGTAGCACCACTGGGTGG - Intronic
944915616 2:204357599-204357621 CGTCTGGGAGGAAGAAAGGGAGG - Intergenic
945317532 2:208386743-208386765 AGTGTAGGAGGAACAGAGGGAGG + Intronic
946191890 2:218011780-218011802 AGACTAGCAGGACCCCAGGGAGG + Intergenic
946208056 2:218125030-218125052 AGTCTGGTAGGCCCACTGGGTGG - Intergenic
946822802 2:223647563-223647585 AGTCTGAGTGGACCAAGGGGTGG - Intergenic
947073716 2:226319077-226319099 AGTCTGGGGGGACCACACACAGG + Intergenic
947911311 2:233802698-233802720 ACTCTGAGTGGACCACAGTGAGG - Intronic
948751885 2:240137800-240137822 TGACTGGGAGGAACACAGTGCGG - Intergenic
948979320 2:241485094-241485116 TGACAGGGAGGACCACAAGGAGG - Intronic
948979333 2:241485158-241485180 AGGGAGGGAGGACCCCAGGGAGG - Intronic
948979353 2:241485230-241485252 AGGGAGGGAGGACTACAGGGAGG - Intronic
948979402 2:241485386-241485408 AGGGAGGGAGGACCACAGGGAGG - Intronic
948979436 2:241485490-241485512 AGTGAGGGAGGACCTCAGGGAGG - Intronic
948979484 2:241485642-241485664 AGTGAGGGAGGACCTCAGGGAGG - Intronic
1168806066 20:672999-673021 AGTCTGGCCGCACCCCAGGGAGG + Intronic
1168959056 20:1855969-1855991 CTTCTGGGAGGAGCACAGTGTGG - Intergenic
1169210603 20:3764399-3764421 AGGTTGGGAGGAAGACAGGGAGG - Intronic
1169245922 20:4024376-4024398 AGGCTGGGAGGCCCAGAGGCTGG + Intergenic
1171978545 20:31610799-31610821 AGGCCAGGAGGAGCACAGGGAGG + Intergenic
1174363559 20:50043113-50043135 TGCCTGGGAGGACCACGTGGAGG + Intergenic
1174547086 20:51333766-51333788 AGAGTGTGAGGACCACAAGGTGG - Intergenic
1176199596 20:63854439-63854461 AGCCTGGACTGACCACAGGGCGG - Intergenic
1178303705 21:31473101-31473123 ATTCTGGGAAGACAACAGAGTGG - Intronic
1179071198 21:38072713-38072735 GGAGGGGGAGGACCACAGGGTGG + Intronic
1179443256 21:41410900-41410922 AGTGGGGAAGGGCCACAGGGAGG + Intergenic
1179469885 21:41603468-41603490 TGTCTTGGAGCACCACAGGCTGG + Intergenic
1180183247 21:46127251-46127273 CGACCTGGAGGACCACAGGGAGG + Intronic
1180326750 22:11436513-11436535 AGTCTAGGAGAACTGCAGGGCGG - Intergenic
1181115705 22:20631582-20631604 AGCCTGGGAAGGCCACACGGGGG + Intergenic
1181236140 22:21448719-21448741 AGGCTGGGATCACCACAGGGAGG - Exonic
1181541300 22:23574556-23574578 AGCCTGGGAGGGCCACACGGGGG - Intronic
1181551197 22:23639915-23639937 AGGCTGGGAGGGCCACACGGGGG - Intergenic
1181604225 22:23970797-23970819 AGGCTGGGAGGACAGCTGGGGGG - Intronic
1183424509 22:37732010-37732032 ACTCTGGGTCCACCACAGGGTGG + Intronic
1183454866 22:37917182-37917204 AGTCTTAGAGGAACCCAGGGTGG + Intronic
1183593994 22:38798691-38798713 AGGGAGGGAGGAGCACAGGGAGG - Intergenic
1183721877 22:39567410-39567432 TTTCTGGGAGCACCACAGTGAGG + Intergenic
1183731794 22:39622458-39622480 AGGCTGGGTGGACCAAGGGGTGG + Intronic
1183735649 22:39643453-39643475 ACTCTGGGAAGACCATATGGGGG - Intronic
1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG + Intronic
1184147995 22:42622683-42622705 TTTCTGGGAGGAGCAGAGGGTGG + Intronic
1184776222 22:46624782-46624804 AAGCTGGGAGGACCCCAGGAGGG - Intronic
1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG + Intronic
950497327 3:13341546-13341568 AGACTGGCAGAACCAGAGGGAGG - Intronic
954665541 3:52249512-52249534 AGTCTGGGAGGGCCACGGGCTGG - Intronic
956718818 3:72100605-72100627 GGACTGGGAGCAGCACAGGGGGG - Intergenic
961537172 3:127577202-127577224 AGTCAGGGTGGGACACAGGGAGG + Intronic
962601621 3:136995529-136995551 TGTCTGGGAGGACCACCACGGGG - Exonic
965834126 3:172832109-172832131 GGTCAGGGAGGAGCACAGAGCGG + Intergenic
966217095 3:177515073-177515095 AGACTGGGAGTGCCACAGGAAGG + Intergenic
966408213 3:179621319-179621341 ATTTTGGGAGGCCCAGAGGGTGG - Intronic
966710986 3:182972794-182972816 ACTCTGGGAGGCCAAGAGGGGGG + Intronic
966863773 3:184244988-184245010 TGTCTGGGAGGAAGACAGGATGG + Intronic
967893283 3:194378508-194378530 ATGCTGGTAGGACCCCAGGGAGG + Intergenic
969258853 4:6021311-6021333 AGGCTGGGAGGAACGGAGGGAGG + Intergenic
970382933 4:15526105-15526127 AGTCTGGGATGTGCAGAGGGAGG - Intronic
970530091 4:16972789-16972811 AGTGTGGTAGGACTTCAGGGAGG + Intergenic
970589395 4:17546279-17546301 AGTATGGAAGGAACACAGGCAGG + Intergenic
972605620 4:40610729-40610751 GGTGTGGGAGGAACCCAGGGGGG + Intronic
973968922 4:56191400-56191422 AGACAGGGAGGAACAGAGGGAGG - Intronic
975387276 4:73772001-73772023 AGTATGGCAGGAACACAGAGAGG + Intergenic
975532320 4:75413120-75413142 AGTCCAGGAGGACAACAAGGAGG - Intergenic
975588638 4:75978025-75978047 ACTGAGGGAGGGCCACAGGGAGG + Intronic
976223184 4:82774673-82774695 ATGCTGGGAGGAGCAAAGGGTGG - Intronic
977305414 4:95318063-95318085 AGCCTGGGAGGACAGCAGAGGGG + Intronic
977870842 4:102088849-102088871 AGACGGGGAGGAATACAGGGAGG + Intergenic
980069464 4:128228296-128228318 ACTCTGGCAGGAACACTGGGAGG + Intergenic
983252601 4:165361676-165361698 AGACTGGGAGGAAAACAGGGTGG + Intronic
983990363 4:174111595-174111617 ATTCTGGCAGGAGGACAGGGAGG - Intergenic
986020324 5:3795600-3795622 AGGATGGGAGGACCTCAGGAAGG - Intergenic
986241285 5:5961958-5961980 AGTCTGGGAGGGCCACGGCTGGG - Intergenic
987175884 5:15308948-15308970 AGGCTGGGAAGACAACAGAGAGG + Intergenic
988510633 5:31861761-31861783 AGTCTGGGAGGCACAAAGGGTGG - Intronic
989235666 5:39145879-39145901 AGAATGGGAGGACCACAAGCAGG - Intronic
989694441 5:44183426-44183448 AGCCTGGTAGCACCACTGGGTGG - Intergenic
990145495 5:52755910-52755932 ACTCTGGGAGGCCCAGTGGGTGG + Intergenic
990168834 5:53024766-53024788 AGTGTGGCTGGAACACAGGGAGG + Intronic
992638347 5:78747107-78747129 CGTCTGGGCGGTCCAGAGGGCGG + Intronic
993018541 5:82563849-82563871 AGTCTGTGAGGACCAGGGGCTGG + Intergenic
995986972 5:118188564-118188586 AGGCTGGGAAGGCTACAGGGAGG + Intergenic
996616022 5:125441787-125441809 AGCCTGGGAGCCCCACTGGGTGG + Intergenic
997059018 5:130478679-130478701 AGTCTGGTAGCCCCACTGGGTGG - Intergenic
997769033 5:136535642-136535664 AGTTTGGGAGGAGCAAAGGGTGG + Intergenic
997895199 5:137709780-137709802 AGGCTGCCAGGACCACACGGTGG + Exonic
998039678 5:138944437-138944459 AGTGTGGGAGGATGGCAGGGAGG - Intergenic
998415290 5:141941559-141941581 AGTGTGAGAGGACGAGAGGGAGG + Exonic
999184021 5:149691996-149692018 AGTTCGGAAGGACCACAGTGTGG + Intergenic
999200732 5:149814474-149814496 GGTCAGTGAGGACCAGAGGGGGG + Intronic
999499680 5:152134325-152134347 ATTCTGGGAGGACTTCAGGGAGG + Intergenic
999732349 5:154484068-154484090 GGTCTCGGAGGGCCGCAGGGTGG - Intergenic
1001411543 5:171515753-171515775 AGTCCGCAAGGACCACAGGCTGG - Intergenic
1001447705 5:171798614-171798636 AATCCGGAAGGAGCACAGGGCGG - Intergenic
1002466293 5:179410474-179410496 AGCCAGGGAGGACCAGAGGATGG + Intergenic
1002522978 5:179801521-179801543 AGACAGGGAGGAGCACGGGGTGG - Intronic
1003398367 6:5772061-5772083 AGTCTTGGAGGCACACAGAGGGG + Intergenic
1003523749 6:6881529-6881551 ACACTGGGAGGATGACAGGGAGG - Intergenic
1004039279 6:11959874-11959896 AGTGTGGTAGGAACACAGTGTGG + Intergenic
1005808262 6:29495290-29495312 AGTGTGGGAGGAACAGAGTGGGG - Intergenic
1006448345 6:34092179-34092201 AGGCTGTGGGGACCAAAGGGAGG - Intronic
1007790836 6:44307223-44307245 AGTCTGGAAGGGCTACAGAGAGG - Exonic
1010015555 6:71101762-71101784 AGTCTGGTAGCCCCACTGGGTGG - Intergenic
1011634997 6:89363296-89363318 TGTCTGGCAGAAGCACAGGGAGG + Intergenic
1011672665 6:89698103-89698125 AGTCTTAGATGACCACAGTGAGG - Intronic
1013155208 6:107486868-107486890 AGGATGGGAAGACCCCAGGGTGG - Intergenic
1016893681 6:149032327-149032349 AGACTGGGAAGACAGCAGGGAGG - Intronic
1018907608 6:168084600-168084622 TGTTTGGGAGCAGCACAGGGAGG - Intergenic
1019421409 7:952957-952979 AGGCTGGGAGGCCCAGAGGGTGG + Intronic
1019737842 7:2659353-2659375 AAGCTGGGAGGGCCACAGTGGGG - Intronic
1020259112 7:6520759-6520781 AGTCTGCTGGGACCACAGGCGGG + Exonic
1020440833 7:8215043-8215065 AGGCTGGGAGAACTACTGGGAGG - Intronic
1020997420 7:15280986-15281008 AGTGTGGCAGCACCACTGGGTGG + Intronic
1021081486 7:16370477-16370499 AGTCTGGTAGCCCCACTGGGTGG + Intronic
1021761917 7:23910615-23910637 AGGCTGGGAGAACCACAGGCAGG + Intergenic
1022036180 7:26537018-26537040 ACCCTGGGAGGACCACGGGGTGG + Exonic
1023701049 7:42892218-42892240 AGTCTGTGAGTATCACTGGGGGG - Intergenic
1024047710 7:45596440-45596462 AGTCTGGGAGGGCTTCTGGGTGG + Intronic
1027149623 7:75723619-75723641 GATGTGGGAGGACCAGAGGGAGG - Intronic
1027264597 7:76487455-76487477 GGTCTTGGAGGAGCAGAGGGAGG - Intronic
1027315967 7:76985557-76985579 GGTCTTGGAGGAGCAGAGGGAGG - Intergenic
1027899047 7:84085277-84085299 AGTTTAGGAGGAGCAAAGGGAGG + Intronic
1029433401 7:100547197-100547219 AGTCTGGGAGAACAGCAGCGAGG - Intronic
1029595489 7:101535514-101535536 GGGCCGGGAAGACCACAGGGAGG - Intronic
1029729463 7:102429888-102429910 AGTCAGGGAGGAGCAAAGAGAGG + Intergenic
1029733980 7:102455450-102455472 AGCATGGAAGGACCCCAGGGAGG + Exonic
1032239325 7:130148800-130148822 AGTCTGGCAAGATCACAGGAAGG + Intergenic
1035105076 7:156435238-156435260 AGGTTGGGAGGACGCCAGGGAGG + Intergenic
1035148318 7:156843107-156843129 AGACTGGGAGAACAACAGAGAGG - Intronic
1035238135 7:157513462-157513484 AGTCTGGGACGTTCACAGGAAGG - Intergenic
1036975394 8:13405304-13405326 AGTCACTGAGGACCACAGAGGGG - Intronic
1037243887 8:16808575-16808597 AGGCGAGGAGAACCACAGGGAGG + Intergenic
1037549832 8:19959376-19959398 ACTCTGTGAGTAGCACAGGGGGG + Exonic
1037590944 8:20311531-20311553 AATCTGGGAGGAGCATAAGGGGG + Intergenic
1037821771 8:22138613-22138635 AGTGTGGGAGGACGACAGGAGGG - Intronic
1040305774 8:46211038-46211060 GGTGTGGGAGGGCCACAGTGTGG + Intergenic
1040308294 8:46223589-46223611 AGGCTGGGAGCACCCCAAGGAGG + Intergenic
1040692257 8:49953325-49953347 AGTCTGAGAGGACCCTTGGGGGG + Intronic
1041489966 8:58422679-58422701 AGTCTGGGAGTGCCCCAGTGGGG + Intronic
1044248889 8:89984141-89984163 AGCATGGGCGGACCACACGGGGG - Intronic
1045193220 8:99904047-99904069 AGTCAGGGCTGAGCACAGGGAGG - Intergenic
1046560013 8:115824285-115824307 AGTCTGGAATGAATACAGGGAGG + Intergenic
1048833470 8:138497398-138497420 AGTCTGGGAGGGCCGCACGCGGG - Intergenic
1048861409 8:138726934-138726956 AGTCTGGGGTGACCAGAGGGAGG + Intronic
1048887235 8:138918255-138918277 AGTCTGGGAAGACCTCTTGGGGG + Intergenic
1049031838 8:140043870-140043892 AGGCTGGGAGGGCCACTGGAGGG - Intronic
1049631432 8:143660384-143660406 AGTCTGGGAGGAGGCCAAGGCGG - Intergenic
1049635302 8:143684964-143684986 TGCCTGGGAGGACCAGAGGGTGG - Intronic
1052532542 9:29706345-29706367 AGTCTGTCAGGACCACACAGGGG - Intergenic
1057142260 9:92734745-92734767 AGCCTAGGAGGCCCACAGTGAGG - Intronic
1057221213 9:93258984-93259006 GGTCTGGGAGGGCCGGAGGGAGG - Exonic
1057797916 9:98171599-98171621 AGTCAGGGAGGGCCCCCGGGAGG + Intronic
1057906290 9:98986021-98986043 AGCCTGGGAGGACCGCTGGAAGG - Exonic
1060035381 9:120251138-120251160 AGTCTGGAAGTACCAAATGGAGG + Intergenic
1060588727 9:124802680-124802702 GGTCGAGGAGGACCACAGGGAGG - Intronic
1061153989 9:128846084-128846106 GGCCTGGGAGGAACACCGGGAGG - Intronic
1061569507 9:131468139-131468161 ACCTTGGGAGGACCCCAGGGTGG - Intronic
1062129659 9:134885620-134885642 AGTCTGTGAGGAGAACAGGTGGG + Intronic
1062348111 9:136124798-136124820 AGGCTGAGGGGACCGCAGGGAGG - Intergenic
1062645116 9:137543899-137543921 ACTGTGGGAGGCCCACAGGCAGG - Intronic
1188114065 X:26222753-26222775 AGCCTTGGAAGACCACAGGCAGG + Intergenic
1191218968 X:57965360-57965382 GGACTGAGAGGAGCACAGGGAGG + Intergenic
1192496787 X:71621576-71621598 AGACTGGAAGGACACCAGGGAGG - Intergenic
1194181513 X:90716188-90716210 AGCCTGGTAGCCCCACAGGGTGG + Intergenic
1200047982 X:153412707-153412729 AGTGTGGCAGGAGCAGAGGGAGG + Intergenic
1200078989 X:153566283-153566305 ACTCTGGCAGGACCTCAGGGAGG - Intronic
1202305476 Y:23465660-23465682 AGTCTGGCAGGACAACAGACAGG - Intergenic
1202380336 Y:24271443-24271465 GGTCTGGGAGGAGGAGAGGGTGG - Intergenic
1202490447 Y:25398682-25398704 GGTCTGGGAGGAGGAGAGGGTGG + Intergenic
1202565333 Y:26204929-26204951 AGTCTGGCAGGACAACAGACAGG + Intergenic