ID: 1184101603

View in Genome Browser
Species Human (GRCh38)
Location 22:42344006-42344028
Sequence GAGCCCCCCCTACCCCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184101603_1184101614 21 Left 1184101603 22:42344006-42344028 CCGGGCTGGGGTAGGGGGGGCTC No data
Right 1184101614 22:42344050-42344072 CGCGCCCAGCCCCCCACGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184101603 Original CRISPR GAGCCCCCCCTACCCCAGCC CGG (reversed) Intergenic
No off target data available for this crispr