ID: 1184101604

View in Genome Browser
Species Human (GRCh38)
Location 22:42344031-42344053
Sequence CGCGGGTGGGCGGGGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184101604_1184101625 11 Left 1184101604 22:42344031-42344053 CCTCCAGCCCCCGCCCACCCGCG No data
Right 1184101625 22:42344065-42344087 ACGCACGGTGCCGCTGCTGGGGG No data
1184101604_1184101624 10 Left 1184101604 22:42344031-42344053 CCTCCAGCCCCCGCCCACCCGCG No data
Right 1184101624 22:42344064-42344086 CACGCACGGTGCCGCTGCTGGGG No data
1184101604_1184101621 8 Left 1184101604 22:42344031-42344053 CCTCCAGCCCCCGCCCACCCGCG No data
Right 1184101621 22:42344062-42344084 CCCACGCACGGTGCCGCTGCTGG No data
1184101604_1184101614 -4 Left 1184101604 22:42344031-42344053 CCTCCAGCCCCCGCCCACCCGCG No data
Right 1184101614 22:42344050-42344072 CGCGCCCAGCCCCCCACGCACGG No data
1184101604_1184101623 9 Left 1184101604 22:42344031-42344053 CCTCCAGCCCCCGCCCACCCGCG No data
Right 1184101623 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data
1184101604_1184101626 16 Left 1184101604 22:42344031-42344053 CCTCCAGCCCCCGCCCACCCGCG No data
Right 1184101626 22:42344070-42344092 CGGTGCCGCTGCTGGGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184101604 Original CRISPR CGCGGGTGGGCGGGGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr