ID: 1184101607

View in Genome Browser
Species Human (GRCh38)
Location 22:42344039-42344061
Sequence GGGCTGGGCGCGGGTGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184101607_1184101623 1 Left 1184101607 22:42344039-42344061 CCCCGCCCACCCGCGCCCAGCCC No data
Right 1184101623 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data
1184101607_1184101625 3 Left 1184101607 22:42344039-42344061 CCCCGCCCACCCGCGCCCAGCCC No data
Right 1184101625 22:42344065-42344087 ACGCACGGTGCCGCTGCTGGGGG No data
1184101607_1184101621 0 Left 1184101607 22:42344039-42344061 CCCCGCCCACCCGCGCCCAGCCC No data
Right 1184101621 22:42344062-42344084 CCCACGCACGGTGCCGCTGCTGG No data
1184101607_1184101624 2 Left 1184101607 22:42344039-42344061 CCCCGCCCACCCGCGCCCAGCCC No data
Right 1184101624 22:42344064-42344086 CACGCACGGTGCCGCTGCTGGGG No data
1184101607_1184101628 27 Left 1184101607 22:42344039-42344061 CCCCGCCCACCCGCGCCCAGCCC No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101607_1184101626 8 Left 1184101607 22:42344039-42344061 CCCCGCCCACCCGCGCCCAGCCC No data
Right 1184101626 22:42344070-42344092 CGGTGCCGCTGCTGGGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184101607 Original CRISPR GGGCTGGGCGCGGGTGGGCG GGG (reversed) Intergenic
No off target data available for this crispr