ID: 1184101614

View in Genome Browser
Species Human (GRCh38)
Location 22:42344050-42344072
Sequence CGCGCCCAGCCCCCCACGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184101603_1184101614 21 Left 1184101603 22:42344006-42344028 CCGGGCTGGGGTAGGGGGGGCTC No data
Right 1184101614 22:42344050-42344072 CGCGCCCAGCCCCCCACGCACGG No data
1184101604_1184101614 -4 Left 1184101604 22:42344031-42344053 CCTCCAGCCCCCGCCCACCCGCG No data
Right 1184101614 22:42344050-42344072 CGCGCCCAGCCCCCCACGCACGG No data
1184101605_1184101614 -7 Left 1184101605 22:42344034-42344056 CCAGCCCCCGCCCACCCGCGCCC No data
Right 1184101614 22:42344050-42344072 CGCGCCCAGCCCCCCACGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184101614 Original CRISPR CGCGCCCAGCCCCCCACGCA CGG Intergenic
No off target data available for this crispr