ID: 1184101615

View in Genome Browser
Species Human (GRCh38)
Location 22:42344054-42344076
Sequence GGCACCGTGCGTGGGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184101615_1184101626 -7 Left 1184101615 22:42344054-42344076 CCCAGCCCCCCACGCACGGTGCC No data
Right 1184101626 22:42344070-42344092 CGGTGCCGCTGCTGGGGGTGAGG No data
1184101615_1184101628 12 Left 1184101615 22:42344054-42344076 CCCAGCCCCCCACGCACGGTGCC No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184101615 Original CRISPR GGCACCGTGCGTGGGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr