ID: 1184101616

View in Genome Browser
Species Human (GRCh38)
Location 22:42344055-42344077
Sequence CGGCACCGTGCGTGGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184101616_1184101626 -8 Left 1184101616 22:42344055-42344077 CCAGCCCCCCACGCACGGTGCCG No data
Right 1184101626 22:42344070-42344092 CGGTGCCGCTGCTGGGGGTGAGG No data
1184101616_1184101628 11 Left 1184101616 22:42344055-42344077 CCAGCCCCCCACGCACGGTGCCG No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184101616 Original CRISPR CGGCACCGTGCGTGGGGGGC TGG (reversed) Intergenic
No off target data available for this crispr