ID: 1184101623

View in Genome Browser
Species Human (GRCh38)
Location 22:42344063-42344085
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184101609_1184101623 -1 Left 1184101609 22:42344041-42344063 CCGCCCACCCGCGCCCAGCCCCC No data
Right 1184101623 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data
1184101605_1184101623 6 Left 1184101605 22:42344034-42344056 CCAGCCCCCGCCCACCCGCGCCC No data
Right 1184101623 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data
1184101613_1184101623 -9 Left 1184101613 22:42344049-42344071 CCGCGCCCAGCCCCCCACGCACG No data
Right 1184101623 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data
1184101608_1184101623 0 Left 1184101608 22:42344040-42344062 CCCGCCCACCCGCGCCCAGCCCC No data
Right 1184101623 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data
1184101612_1184101623 -8 Left 1184101612 22:42344048-42344070 CCCGCGCCCAGCCCCCCACGCAC No data
Right 1184101623 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data
1184101604_1184101623 9 Left 1184101604 22:42344031-42344053 CCTCCAGCCCCCGCCCACCCGCG No data
Right 1184101623 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data
1184101606_1184101623 2 Left 1184101606 22:42344038-42344060 CCCCCGCCCACCCGCGCCCAGCC No data
Right 1184101623 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data
1184101607_1184101623 1 Left 1184101607 22:42344039-42344061 CCCCGCCCACCCGCGCCCAGCCC No data
Right 1184101623 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data
1184101610_1184101623 -4 Left 1184101610 22:42344044-42344066 CCCACCCGCGCCCAGCCCCCCAC No data
Right 1184101623 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data
1184101611_1184101623 -5 Left 1184101611 22:42344045-42344067 CCACCCGCGCCCAGCCCCCCACG No data
Right 1184101623 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184101623 Original CRISPR CCACGCACGGTGCCGCTGCT GGG Intergenic
No off target data available for this crispr