ID: 1184101628

View in Genome Browser
Species Human (GRCh38)
Location 22:42344089-42344111
Sequence GAGGCCAGCCCCCACTCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184101622_1184101628 3 Left 1184101622 22:42344063-42344085 CCACGCACGGTGCCGCTGCTGGG No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101611_1184101628 21 Left 1184101611 22:42344045-42344067 CCACCCGCGCCCAGCCCCCCACG No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101615_1184101628 12 Left 1184101615 22:42344054-42344076 CCCAGCCCCCCACGCACGGTGCC No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101617_1184101628 7 Left 1184101617 22:42344059-42344081 CCCCCCACGCACGGTGCCGCTGC No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101607_1184101628 27 Left 1184101607 22:42344039-42344061 CCCCGCCCACCCGCGCCCAGCCC No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101612_1184101628 18 Left 1184101612 22:42344048-42344070 CCCGCGCCCAGCCCCCCACGCAC No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101620_1184101628 4 Left 1184101620 22:42344062-42344084 CCCACGCACGGTGCCGCTGCTGG No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101613_1184101628 17 Left 1184101613 22:42344049-42344071 CCGCGCCCAGCCCCCCACGCACG No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101627_1184101628 -9 Left 1184101627 22:42344075-42344097 CCGCTGCTGGGGGTGAGGCCAGC No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101610_1184101628 22 Left 1184101610 22:42344044-42344066 CCCACCCGCGCCCAGCCCCCCAC No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101609_1184101628 25 Left 1184101609 22:42344041-42344063 CCGCCCACCCGCGCCCAGCCCCC No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101608_1184101628 26 Left 1184101608 22:42344040-42344062 CCCGCCCACCCGCGCCCAGCCCC No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101619_1184101628 5 Left 1184101619 22:42344061-42344083 CCCCACGCACGGTGCCGCTGCTG No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101618_1184101628 6 Left 1184101618 22:42344060-42344082 CCCCCACGCACGGTGCCGCTGCT No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101616_1184101628 11 Left 1184101616 22:42344055-42344077 CCAGCCCCCCACGCACGGTGCCG No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data
1184101606_1184101628 28 Left 1184101606 22:42344038-42344060 CCCCCGCCCACCCGCGCCCAGCC No data
Right 1184101628 22:42344089-42344111 GAGGCCAGCCCCCACTCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184101628 Original CRISPR GAGGCCAGCCCCCACTCCAC CGG Intergenic
No off target data available for this crispr