ID: 1184101753

View in Genome Browser
Species Human (GRCh38)
Location 22:42344556-42344578
Sequence GCATCGCAGGTCCCCCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184101742_1184101753 3 Left 1184101742 22:42344530-42344552 CCCGCCCCAGCCTGCCATACCCC No data
Right 1184101753 22:42344556-42344578 GCATCGCAGGTCCCCCTCTGTGG No data
1184101745_1184101753 -2 Left 1184101745 22:42344535-42344557 CCCAGCCTGCCATACCCCAGTGC No data
Right 1184101753 22:42344556-42344578 GCATCGCAGGTCCCCCTCTGTGG No data
1184101741_1184101753 24 Left 1184101741 22:42344509-42344531 CCTGGGAGGCGCGCGAGTTCTCC No data
Right 1184101753 22:42344556-42344578 GCATCGCAGGTCCCCCTCTGTGG No data
1184101744_1184101753 -1 Left 1184101744 22:42344534-42344556 CCCCAGCCTGCCATACCCCAGTG No data
Right 1184101753 22:42344556-42344578 GCATCGCAGGTCCCCCTCTGTGG No data
1184101740_1184101753 29 Left 1184101740 22:42344504-42344526 CCTGGCCTGGGAGGCGCGCGAGT No data
Right 1184101753 22:42344556-42344578 GCATCGCAGGTCCCCCTCTGTGG No data
1184101747_1184101753 -7 Left 1184101747 22:42344540-42344562 CCTGCCATACCCCAGTGCATCGC No data
Right 1184101753 22:42344556-42344578 GCATCGCAGGTCCCCCTCTGTGG No data
1184101746_1184101753 -3 Left 1184101746 22:42344536-42344558 CCAGCCTGCCATACCCCAGTGCA No data
Right 1184101753 22:42344556-42344578 GCATCGCAGGTCCCCCTCTGTGG No data
1184101743_1184101753 2 Left 1184101743 22:42344531-42344553 CCGCCCCAGCCTGCCATACCCCA No data
Right 1184101753 22:42344556-42344578 GCATCGCAGGTCCCCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184101753 Original CRISPR GCATCGCAGGTCCCCCTCTG TGG Intergenic
No off target data available for this crispr