ID: 1184105123

View in Genome Browser
Species Human (GRCh38)
Location 22:42362981-42363003
Sequence CCCTCCGGCCTAGGATGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184105123_1184105138 23 Left 1184105123 22:42362981-42363003 CCCTCCCATCCTAGGCCGGAGGG No data
Right 1184105138 22:42363027-42363049 GGGCCCAGGACACACTCATGCGG No data
1184105123_1184105131 2 Left 1184105123 22:42362981-42363003 CCCTCCCATCCTAGGCCGGAGGG No data
Right 1184105131 22:42363006-42363028 CTAGCCAGCAACCTGCCTCCTGG No data
1184105123_1184105132 3 Left 1184105123 22:42362981-42363003 CCCTCCCATCCTAGGCCGGAGGG No data
Right 1184105132 22:42363007-42363029 TAGCCAGCAACCTGCCTCCTGGG No data
1184105123_1184105134 9 Left 1184105123 22:42362981-42363003 CCCTCCCATCCTAGGCCGGAGGG No data
Right 1184105134 22:42363013-42363035 GCAACCTGCCTCCTGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184105123 Original CRISPR CCCTCCGGCCTAGGATGGGA GGG (reversed) Intergenic
No off target data available for this crispr