ID: 1184105128

View in Genome Browser
Species Human (GRCh38)
Location 22:42362990-42363012
Sequence TGGCTAGGACCCTCCGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184105128_1184105132 -6 Left 1184105128 22:42362990-42363012 CCTAGGCCGGAGGGTCCTAGCCA No data
Right 1184105132 22:42363007-42363029 TAGCCAGCAACCTGCCTCCTGGG No data
1184105128_1184105131 -7 Left 1184105128 22:42362990-42363012 CCTAGGCCGGAGGGTCCTAGCCA No data
Right 1184105131 22:42363006-42363028 CTAGCCAGCAACCTGCCTCCTGG No data
1184105128_1184105141 25 Left 1184105128 22:42362990-42363012 CCTAGGCCGGAGGGTCCTAGCCA No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data
1184105128_1184105138 14 Left 1184105128 22:42362990-42363012 CCTAGGCCGGAGGGTCCTAGCCA No data
Right 1184105138 22:42363027-42363049 GGGCCCAGGACACACTCATGCGG No data
1184105128_1184105134 0 Left 1184105128 22:42362990-42363012 CCTAGGCCGGAGGGTCCTAGCCA No data
Right 1184105134 22:42363013-42363035 GCAACCTGCCTCCTGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184105128 Original CRISPR TGGCTAGGACCCTCCGGCCT AGG (reversed) Intergenic
No off target data available for this crispr