ID: 1184105129

View in Genome Browser
Species Human (GRCh38)
Location 22:42362996-42363018
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184105129_1184105134 -6 Left 1184105129 22:42362996-42363018 CCGGAGGGTCCTAGCCAGCAACC No data
Right 1184105134 22:42363013-42363035 GCAACCTGCCTCCTGGGCCCAGG No data
1184105129_1184105142 29 Left 1184105129 22:42362996-42363018 CCGGAGGGTCCTAGCCAGCAACC No data
Right 1184105142 22:42363048-42363070 GGCTAATGCTTGGTCAGTCCAGG No data
1184105129_1184105141 19 Left 1184105129 22:42362996-42363018 CCGGAGGGTCCTAGCCAGCAACC No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data
1184105129_1184105138 8 Left 1184105129 22:42362996-42363018 CCGGAGGGTCCTAGCCAGCAACC No data
Right 1184105138 22:42363027-42363049 GGGCCCAGGACACACTCATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184105129 Original CRISPR GGTTGCTGGCTAGGACCCTC CGG (reversed) Intergenic
No off target data available for this crispr