ID: 1184105133

View in Genome Browser
Species Human (GRCh38)
Location 22:42363010-42363032
Sequence GGGCCCAGGAGGCAGGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184105133_1184105138 -6 Left 1184105133 22:42363010-42363032 CCAGCAACCTGCCTCCTGGGCCC No data
Right 1184105138 22:42363027-42363049 GGGCCCAGGACACACTCATGCGG No data
1184105133_1184105142 15 Left 1184105133 22:42363010-42363032 CCAGCAACCTGCCTCCTGGGCCC No data
Right 1184105142 22:42363048-42363070 GGCTAATGCTTGGTCAGTCCAGG No data
1184105133_1184105141 5 Left 1184105133 22:42363010-42363032 CCAGCAACCTGCCTCCTGGGCCC No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data
1184105133_1184105143 25 Left 1184105133 22:42363010-42363032 CCAGCAACCTGCCTCCTGGGCCC No data
Right 1184105143 22:42363058-42363080 TGGTCAGTCCAGGCCTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184105133 Original CRISPR GGGCCCAGGAGGCAGGTTGC TGG (reversed) Intergenic
No off target data available for this crispr