ID: 1184105135

View in Genome Browser
Species Human (GRCh38)
Location 22:42363017-42363039
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184105135_1184105141 -2 Left 1184105135 22:42363017-42363039 CCTGCCTCCTGGGCCCAGGACAC No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data
1184105135_1184105142 8 Left 1184105135 22:42363017-42363039 CCTGCCTCCTGGGCCCAGGACAC No data
Right 1184105142 22:42363048-42363070 GGCTAATGCTTGGTCAGTCCAGG No data
1184105135_1184105143 18 Left 1184105135 22:42363017-42363039 CCTGCCTCCTGGGCCCAGGACAC No data
Right 1184105143 22:42363058-42363080 TGGTCAGTCCAGGCCTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184105135 Original CRISPR GTGTCCTGGGCCCAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr