ID: 1184105138

View in Genome Browser
Species Human (GRCh38)
Location 22:42363027-42363049
Sequence GGGCCCAGGACACACTCATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184105123_1184105138 23 Left 1184105123 22:42362981-42363003 CCCTCCCATCCTAGGCCGGAGGG No data
Right 1184105138 22:42363027-42363049 GGGCCCAGGACACACTCATGCGG No data
1184105129_1184105138 8 Left 1184105129 22:42362996-42363018 CCGGAGGGTCCTAGCCAGCAACC No data
Right 1184105138 22:42363027-42363049 GGGCCCAGGACACACTCATGCGG No data
1184105130_1184105138 -1 Left 1184105130 22:42363005-42363027 CCTAGCCAGCAACCTGCCTCCTG No data
Right 1184105138 22:42363027-42363049 GGGCCCAGGACACACTCATGCGG No data
1184105125_1184105138 22 Left 1184105125 22:42362982-42363004 CCTCCCATCCTAGGCCGGAGGGT No data
Right 1184105138 22:42363027-42363049 GGGCCCAGGACACACTCATGCGG No data
1184105127_1184105138 18 Left 1184105127 22:42362986-42363008 CCATCCTAGGCCGGAGGGTCCTA No data
Right 1184105138 22:42363027-42363049 GGGCCCAGGACACACTCATGCGG No data
1184105133_1184105138 -6 Left 1184105133 22:42363010-42363032 CCAGCAACCTGCCTCCTGGGCCC No data
Right 1184105138 22:42363027-42363049 GGGCCCAGGACACACTCATGCGG No data
1184105128_1184105138 14 Left 1184105128 22:42362990-42363012 CCTAGGCCGGAGGGTCCTAGCCA No data
Right 1184105138 22:42363027-42363049 GGGCCCAGGACACACTCATGCGG No data
1184105126_1184105138 19 Left 1184105126 22:42362985-42363007 CCCATCCTAGGCCGGAGGGTCCT No data
Right 1184105138 22:42363027-42363049 GGGCCCAGGACACACTCATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184105138 Original CRISPR GGGCCCAGGACACACTCATG CGG Intergenic
No off target data available for this crispr