ID: 1184105141

View in Genome Browser
Species Human (GRCh38)
Location 22:42363038-42363060
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184105136_1184105141 -6 Left 1184105136 22:42363021-42363043 CCTCCTGGGCCCAGGACACACTC No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data
1184105128_1184105141 25 Left 1184105128 22:42362990-42363012 CCTAGGCCGGAGGGTCCTAGCCA No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data
1184105137_1184105141 -9 Left 1184105137 22:42363024-42363046 CCTGGGCCCAGGACACACTCATG No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data
1184105126_1184105141 30 Left 1184105126 22:42362985-42363007 CCCATCCTAGGCCGGAGGGTCCT No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data
1184105133_1184105141 5 Left 1184105133 22:42363010-42363032 CCAGCAACCTGCCTCCTGGGCCC No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data
1184105135_1184105141 -2 Left 1184105135 22:42363017-42363039 CCTGCCTCCTGGGCCCAGGACAC No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data
1184105129_1184105141 19 Left 1184105129 22:42362996-42363018 CCGGAGGGTCCTAGCCAGCAACC No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data
1184105127_1184105141 29 Left 1184105127 22:42362986-42363008 CCATCCTAGGCCGGAGGGTCCTA No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data
1184105130_1184105141 10 Left 1184105130 22:42363005-42363027 CCTAGCCAGCAACCTGCCTCCTG No data
Right 1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184105141 Original CRISPR ACACTCATGCGGCTAATGCT TGG Intergenic