ID: 1184105142

View in Genome Browser
Species Human (GRCh38)
Location 22:42363048-42363070
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184105136_1184105142 4 Left 1184105136 22:42363021-42363043 CCTCCTGGGCCCAGGACACACTC No data
Right 1184105142 22:42363048-42363070 GGCTAATGCTTGGTCAGTCCAGG No data
1184105137_1184105142 1 Left 1184105137 22:42363024-42363046 CCTGGGCCCAGGACACACTCATG No data
Right 1184105142 22:42363048-42363070 GGCTAATGCTTGGTCAGTCCAGG No data
1184105130_1184105142 20 Left 1184105130 22:42363005-42363027 CCTAGCCAGCAACCTGCCTCCTG No data
Right 1184105142 22:42363048-42363070 GGCTAATGCTTGGTCAGTCCAGG No data
1184105140_1184105142 -6 Left 1184105140 22:42363031-42363053 CCAGGACACACTCATGCGGCTAA No data
Right 1184105142 22:42363048-42363070 GGCTAATGCTTGGTCAGTCCAGG No data
1184105139_1184105142 -5 Left 1184105139 22:42363030-42363052 CCCAGGACACACTCATGCGGCTA No data
Right 1184105142 22:42363048-42363070 GGCTAATGCTTGGTCAGTCCAGG No data
1184105129_1184105142 29 Left 1184105129 22:42362996-42363018 CCGGAGGGTCCTAGCCAGCAACC No data
Right 1184105142 22:42363048-42363070 GGCTAATGCTTGGTCAGTCCAGG No data
1184105133_1184105142 15 Left 1184105133 22:42363010-42363032 CCAGCAACCTGCCTCCTGGGCCC No data
Right 1184105142 22:42363048-42363070 GGCTAATGCTTGGTCAGTCCAGG No data
1184105135_1184105142 8 Left 1184105135 22:42363017-42363039 CCTGCCTCCTGGGCCCAGGACAC No data
Right 1184105142 22:42363048-42363070 GGCTAATGCTTGGTCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184105142 Original CRISPR GGCTAATGCTTGGTCAGTCC AGG Intergenic