ID: 1184106919

View in Genome Browser
Species Human (GRCh38)
Location 22:42373093-42373115
Sequence CATTTCTGATTGATTTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184106915_1184106919 16 Left 1184106915 22:42373054-42373076 CCTACCCAGTAAATCTTAACGCC No data
Right 1184106919 22:42373093-42373115 CATTTCTGATTGATTTTCCCTGG No data
1184106916_1184106919 12 Left 1184106916 22:42373058-42373080 CCCAGTAAATCTTAACGCCTCTG No data
Right 1184106919 22:42373093-42373115 CATTTCTGATTGATTTTCCCTGG No data
1184106914_1184106919 23 Left 1184106914 22:42373047-42373069 CCGTTGGCCTACCCAGTAAATCT No data
Right 1184106919 22:42373093-42373115 CATTTCTGATTGATTTTCCCTGG No data
1184106917_1184106919 11 Left 1184106917 22:42373059-42373081 CCAGTAAATCTTAACGCCTCTGA No data
Right 1184106919 22:42373093-42373115 CATTTCTGATTGATTTTCCCTGG No data
1184106913_1184106919 24 Left 1184106913 22:42373046-42373068 CCCGTTGGCCTACCCAGTAAATC No data
Right 1184106919 22:42373093-42373115 CATTTCTGATTGATTTTCCCTGG No data
1184106918_1184106919 -5 Left 1184106918 22:42373075-42373097 CCTCTGATGCTCTAGCTTCATTT No data
Right 1184106919 22:42373093-42373115 CATTTCTGATTGATTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184106919 Original CRISPR CATTTCTGATTGATTTTCCC TGG Intergenic
No off target data available for this crispr