ID: 1184108865

View in Genome Browser
Species Human (GRCh38)
Location 22:42383757-42383779
Sequence CCCTGGGCACATTTGGGGTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184108849_1184108865 1 Left 1184108849 22:42383733-42383755 CCTGTGCCTTGGGTTCCCCCCCC 0: 1
1: 0
2: 0
3: 18
4: 284
Right 1184108865 22:42383757-42383779 CCCTGGGCACATTTGGGGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 186
1184108850_1184108865 -5 Left 1184108850 22:42383739-42383761 CCTTGGGTTCCCCCCCCTCCCTG 0: 1
1: 0
2: 2
3: 61
4: 548
Right 1184108865 22:42383757-42383779 CCCTGGGCACATTTGGGGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 186
1184108842_1184108865 29 Left 1184108842 22:42383705-42383727 CCAGTGCTGCTTGGGGGCAGGGG 0: 1
1: 0
2: 6
3: 49
4: 415
Right 1184108865 22:42383757-42383779 CCCTGGGCACATTTGGGGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 186
1184108840_1184108865 30 Left 1184108840 22:42383704-42383726 CCCAGTGCTGCTTGGGGGCAGGG 0: 1
1: 0
2: 5
3: 55
4: 355
Right 1184108865 22:42383757-42383779 CCCTGGGCACATTTGGGGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184108865 Original CRISPR CCCTGGGCACATTTGGGGTT GGG Exonic
900210011 1:1450786-1450808 GCCGGGGCACACATGGGGTTCGG + Intronic
902234577 1:15049193-15049215 CCCTAGTCACATGTGGGGCTGGG + Intronic
902926763 1:19700919-19700941 CCCTGGCCACATTGGGTGCTGGG + Intronic
903350481 1:22713564-22713586 GCCTGTGCACATTTGGGGGGCGG + Intronic
904313950 1:29647939-29647961 CCATGGGCAAGGTTGGGGTTTGG + Intergenic
905273436 1:36801834-36801856 CCCTAGGCACAGCTGGGGTGGGG - Exonic
907395146 1:54184518-54184540 CCCTGTGGGCATTTGGGTTTGGG - Intronic
912147644 1:106813058-106813080 GGCTGGGAAGATTTGGGGTTTGG + Intergenic
918244078 1:182643735-182643757 CCTTGGGCACCTCTGGGGTGAGG - Intergenic
919252265 1:195071649-195071671 ACCTGTGCACATTTGGGACTAGG - Intergenic
919730385 1:200909819-200909841 CCCTGGGGAAATATAGGGTTAGG + Intronic
1067282301 10:44881608-44881630 CCCTGGTCACACTTGGGCCTGGG - Intergenic
1067509777 10:46885169-46885191 CCATGCCCACATTTGGGGTAAGG + Intergenic
1067652477 10:48166689-48166711 CCATGCCCACATTTGGGGTAAGG - Intronic
1069949866 10:72011370-72011392 CTCTGGGAACCCTTGGGGTTTGG + Exonic
1070005698 10:72422069-72422091 CATTGGGCACAGTAGGGGTTAGG - Intronic
1070249354 10:74760449-74760471 CACTGGGCACCTATGGGGGTTGG + Intergenic
1072734132 10:97867620-97867642 CCCTGGGCCCCTGTGGGGCTGGG + Exonic
1072754900 10:98012827-98012849 CACAGGGCACATGTGGGGTGTGG + Intronic
1073763163 10:106652475-106652497 CCCTGGGCACTTCTGCGGTTTGG + Exonic
1075466454 10:122655120-122655142 CCCTGGGCACATTGGGCGCATGG + Intergenic
1076064579 10:127439367-127439389 GCCTTGGGACATTTGAGGTTAGG - Intronic
1076402140 10:130191143-130191165 CCTTGGGGACAGTTGAGGTTCGG + Intergenic
1077230822 11:1457501-1457523 CCCTGGGCCCATGTGTGGTGGGG + Intronic
1078610880 11:12818460-12818482 CCCTGGGGACATGTCTGGTTTGG + Intronic
1078653488 11:13216942-13216964 CCCTGCCCCTATTTGGGGTTTGG + Intergenic
1081148554 11:39597160-39597182 CCCCCGGTACATTTGGGGATCGG - Intergenic
1081876199 11:46410005-46410027 GCCTGGGCACACTTGGGGTGAGG - Intronic
1082718974 11:56649889-56649911 ACCAGGGCCCATTGGGGGTTTGG + Intergenic
1083650059 11:64197941-64197963 TCTTGAGCACATCTGGGGTTCGG - Exonic
1085015838 11:73173642-73173664 CCCAGGGCCCATTTAGGGCTTGG - Intergenic
1085316561 11:75548618-75548640 GTCTGGGCAGAGTTGGGGTTAGG + Intergenic
1089694485 11:120208782-120208804 CTCTGTTCACATTTTGGGTTTGG - Intergenic
1090405091 11:126471649-126471671 CCCTGGGGAGATTTAGGGTAGGG + Intronic
1091072345 11:132579609-132579631 TCCTGGGAACTTTTGGGGATAGG - Intronic
1096134649 12:49189156-49189178 CTCTGGGCAGATTGGGGGTCTGG - Exonic
1096722252 12:53532103-53532125 TCCTGGGCACAGTTGGGGGCTGG + Intronic
1097994102 12:65868895-65868917 CCTTGTCTACATTTGGGGTTTGG - Intronic
1102677547 12:114668818-114668840 CCCTGGGGACCTTTGAGGCTGGG - Intergenic
1102749849 12:115282947-115282969 CTCTGAACAGATTTGGGGTTTGG - Intergenic
1103611294 12:122125825-122125847 GCCTGGGCTCCTTGGGGGTTTGG + Intronic
1104288027 12:127443203-127443225 CCCTGTGGACATTTTGAGTTTGG + Intergenic
1104897251 12:132170518-132170540 CCCCGGGGACATTGGGGGATGGG - Intergenic
1105531021 13:21220587-21220609 CCATGGGCCCAGTTGGGGGTGGG + Intergenic
1107287713 13:38814664-38814686 CCCTGGACACATTTGGGGCCTGG - Intronic
1109979113 13:69883175-69883197 CCATGAGCACATTTATGGTTTGG - Intronic
1111799980 13:92969512-92969534 CACTGGGAACATTTGGGGTCAGG - Intergenic
1112919134 13:104588691-104588713 CCCTGGGAATATTTGGGTATTGG + Intergenic
1118050240 14:62018674-62018696 CCCTGGGGAGATGTGGAGTTTGG - Intronic
1120328580 14:83058574-83058596 TCTTGGGCACATTTAGGATTTGG + Intergenic
1120658157 14:87220679-87220701 CCTTGGGGAGATTTGGGGATTGG + Intergenic
1121246247 14:92462873-92462895 CCCTAAGCACATCTGGGGTCTGG - Intronic
1122687982 14:103518979-103519001 CCCTGGGCAGAAGGGGGGTTGGG - Intergenic
1123040059 14:105486805-105486827 GCCCGGGCAGATCTGGGGTTCGG + Intergenic
1202868421 14_GL000225v1_random:137277-137299 CCCTGGGAACATTCCGGGGTGGG - Intergenic
1124463962 15:29919653-29919675 CCCTGGGCATTTTGGGGGTCTGG + Intronic
1124708738 15:31987189-31987211 CCCTGAGCAGCTTTGGGATTGGG + Intergenic
1124882638 15:33656596-33656618 CCCAGGGCACACTTTGTGTTTGG - Intronic
1125656487 15:41361899-41361921 CTCCTGGCACATTTGGGGCTTGG + Intronic
1134246043 16:12540925-12540947 CCCTGCCCACTTTTGGGGTCAGG + Intronic
1136465496 16:30440726-30440748 ACCAGGGCCCATTGGGGGTTGGG - Intergenic
1137708962 16:50553508-50553530 CCATGGGGACGTGTGGGGTTGGG + Intronic
1139953991 16:70684829-70684851 CCCTGGCCTCATTTGGGGAGAGG + Intronic
1141947951 16:87323214-87323236 ACCTCGGCACAGTTGGTGTTTGG - Intronic
1142312866 16:89323994-89324016 AGCTGGGCACACTGGGGGTTTGG - Intronic
1142986786 17:3700178-3700200 CACTGGGCACAATGGGTGTTTGG - Intergenic
1144029693 17:11308375-11308397 TCCTGTGCACATATGAGGTTAGG - Intronic
1145759531 17:27418414-27418436 CCCTGGACAGATTTGGGATCTGG - Intergenic
1147422825 17:40331111-40331133 GCCTGGGCCCAGATGGGGTTTGG - Exonic
1147881416 17:43656481-43656503 CCTTAGGCAAATTTGTGGTTGGG + Intronic
1150371117 17:64638936-64638958 CTGTGGGCACTTTTGGGGTCTGG - Intronic
1151116028 17:71736280-71736302 GCCTTGGCACATTTGAGGTAAGG + Intergenic
1153130545 18:1851242-1851264 CACTGGGCACCTTTGAGTTTTGG - Intergenic
1153265883 18:3269057-3269079 CCTTGGGGACATTTGCAGTTTGG + Intronic
1153581873 18:6582129-6582151 CCCAGGTTACATTTGGGGTCGGG - Intronic
1153722657 18:7922533-7922555 TGCTGGGCAGATTGGGGGTTGGG + Intronic
1155203655 18:23538542-23538564 CCTTTGCCACACTTGGGGTTAGG + Exonic
1157520996 18:48345486-48345508 CGCAGGGCACCTTGGGGGTTGGG - Intronic
1160062783 18:75548119-75548141 CACTGGGGCCTTTTGGGGTTTGG + Intergenic
1165320200 19:35080347-35080369 CCCTGAGAACCTTTGGGGTGAGG - Intergenic
1165906456 19:39197307-39197329 CCTTGCGCACCTTCGGGGTTGGG - Exonic
1167301598 19:48680869-48680891 CCGTGGGCACCTTCGGGGTCTGG + Intergenic
1167811893 19:51840501-51840523 ACCTGGGTACATTTGGGTGTGGG + Intergenic
925343006 2:3149628-3149650 ACCTGGGCACACCTGGGCTTGGG + Intergenic
927442620 2:23129976-23129998 CCTTGGGCACAGTTGGGTATAGG - Intergenic
927492231 2:23528298-23528320 CCCTGGGCCGGTTTGGGGCTCGG + Intronic
929539905 2:42811262-42811284 CCCTGGGCAGATTTGCAGTTTGG + Intergenic
932185716 2:69693728-69693750 TCCTGGACATATTTGGGGTTAGG + Intronic
932888330 2:75568098-75568120 CCCTGGGCACATGGGAAGTTTGG + Intronic
934991585 2:98925256-98925278 CCCTGTGCACACTTGGGGGGAGG + Intronic
939626259 2:144481259-144481281 CCCGGGGCACACTTGAGGTCAGG - Intronic
939636990 2:144594190-144594212 CCCTGCCCACATTTAGAGTTGGG + Intergenic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
941898312 2:170653131-170653153 CTCTGGACAGATTTAGGGTTAGG - Exonic
944900549 2:204209810-204209832 CTCTGGGCACTACTGGGGTTGGG + Intergenic
1171131060 20:22653198-22653220 CCCTGTTCGCATGTGGGGTTCGG - Intergenic
1172189441 20:33053415-33053437 CTCTGGGCACACTTGGGGGAGGG - Intergenic
1173424776 20:42932990-42933012 GCTTGGTCAGATTTGGGGTTTGG - Intronic
1173840593 20:46154200-46154222 CCGTGGACACCCTTGGGGTTCGG + Intergenic
1174580166 20:51565757-51565779 CTCTGGGCACCTGTGGAGTTGGG - Intergenic
1175570132 20:60012084-60012106 ACCTGAGCACATTTGTGGGTCGG + Intronic
1176164387 20:63665068-63665090 CCCTGGGAGTATCTGGGGTTGGG + Intronic
1177537151 21:22442849-22442871 TCCTGGGAACATCTGGGCTTGGG - Intergenic
1178350208 21:31867431-31867453 CCCTGGGCCCATCTGTAGTTGGG + Intergenic
1179640632 21:42745333-42745355 TCATGGGCTCATTTGGAGTTAGG + Intronic
1180094626 21:45550204-45550226 CCCTGGTCACTTCTGTGGTTTGG + Intergenic
1180643044 22:17314856-17314878 CTCTGCGGACAGTTGGGGTTTGG - Intergenic
1180866892 22:19124824-19124846 CCCAGGGCAGATCTGGGGCTGGG - Intergenic
1180927844 22:19568399-19568421 GCCTGGTCAGATTTGGGTTTAGG + Intergenic
1181281830 22:21726136-21726158 CCCTGGGGACATGTGGGTCTGGG - Intronic
1181624477 22:24113960-24113982 CCCTGAGCACATGTGGTGCTGGG - Intronic
1181780640 22:25190593-25190615 CCCTGGGCCCAGGCGGGGTTGGG - Intronic
1181807321 22:25383082-25383104 CCCTGGGCTAGTTTGGGGTGGGG - Intronic
1183045469 22:35216111-35216133 CTGTGGGCAGATTTGGTGTTTGG + Intergenic
1183317993 22:37147568-37147590 CCCTGGGCAAGTTAGGGGCTTGG - Intronic
1184108865 22:42383757-42383779 CCCTGGGCACATTTGGGGTTGGG + Exonic
949724705 3:7030359-7030381 CCCTAGACACTTTTGGGGGTGGG + Intronic
950140413 3:10611330-10611352 GCCTGGGCATGTTTGGCGTTGGG + Intronic
950179312 3:10900053-10900075 CCCTGGGCAGAAATGGGGGTTGG + Intronic
950495542 3:13331894-13331916 CCCTGGGCAGGTCTGGGGTGGGG + Intronic
953492592 3:43363899-43363921 CCCTGGCCACTTTTGAGGTGAGG + Intronic
954125535 3:48525719-48525741 CCTTGGGGACATGTGGGGTGAGG + Intronic
958820157 3:98964419-98964441 CCCTGGGAACACCTGGAGTTTGG + Intergenic
960363127 3:116737924-116737946 CACTGTGAACATGTGGGGTTGGG - Intronic
960937251 3:122911736-122911758 CCATGCACACATTTGGGGTTTGG - Intronic
961019724 3:123495456-123495478 CCCTGGGACCATATGGGGCTAGG - Intronic
961553022 3:127679834-127679856 CCCTGCGCATGTATGGGGTTGGG - Intronic
961834751 3:129648100-129648122 CCCAGGTTTCATTTGGGGTTGGG + Exonic
962403424 3:135080485-135080507 CCCTGGGGACACTTGGGGGTGGG + Intronic
967160356 3:186731866-186731888 CCCTGGGCAAAGTTGGCCTTTGG + Intronic
969454604 4:7294241-7294263 CTGTGGGCAGATTTGGGGTGGGG + Intronic
973094890 4:46184131-46184153 CACTGGGCACTCATGGGGTTGGG + Intergenic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
984677110 4:182562566-182562588 CCCTGGGCATAGTGGGGGTTGGG + Intronic
985648242 5:1095190-1095212 GCCTGGGCAGGTTTGGGGTCTGG - Intronic
986815620 5:11406282-11406304 CCTTGGGCACATCTGGGATAAGG + Intronic
988617183 5:32785978-32786000 CCCTGGGTGCCTTGGGGGTTAGG - Intronic
993824218 5:92661287-92661309 CCCAGGACACATTTTTGGTTTGG - Intergenic
995357414 5:111254863-111254885 CCCTGGGGACTTTTGTGGTTTGG + Intronic
995566394 5:113435813-113435835 CCCAGGGCATATCTGGGGCTGGG + Intronic
997261749 5:132470629-132470651 CCCTGGGCCCATTCCAGGTTAGG - Intronic
1000408235 5:160911447-160911469 CCCTGGCCACATTTGGTGAACGG - Intergenic
1002306587 5:178287174-178287196 CCCATGGCACACCTGGGGTTAGG - Intronic
1003391642 6:5718343-5718365 CCATGGGCCCAGTTGGGGGTGGG - Intronic
1003924243 6:10861941-10861963 CTCTGGGCACATTTGCTGTGGGG + Intronic
1005870528 6:29971608-29971630 CCCTGGACAGAGTTGGGGGTCGG + Intergenic
1006079578 6:31557704-31557726 CCCTGGCCAAATTTTGGGCTGGG + Exonic
1006635338 6:35457648-35457670 CCTTGGGCATAGTTGGGGTCTGG - Intronic
1006729964 6:36229359-36229381 CACTGGGCACATCTGGAGCTGGG + Intronic
1007701546 6:43769138-43769160 CCCTGGCAACATCTGGGGTTGGG + Intergenic
1008344362 6:50408254-50408276 CCCTAGGCACACTTGGGCTGAGG - Intergenic
1011128062 6:84028263-84028285 TCCTGGGCCCTTCTGGGGTTGGG - Intergenic
1014091975 6:117414195-117414217 CCCTGGGCAGAGTTGGAGTTGGG - Intronic
1015346897 6:132170965-132170987 CCCTTGGCACTTTTGGGATGAGG + Intergenic
1017760186 6:157562496-157562518 CTCTAGGCAGATTTGGGGTGGGG + Intronic
1018641609 6:165908995-165909017 CAGTGGACACATTTTGGGTTTGG + Intronic
1019013142 6:168859074-168859096 CTCTGGGCAAATTTGTGGGTGGG + Intergenic
1019128029 6:169854223-169854245 CCCTGGGCCCATGTTGGCTTTGG + Intergenic
1019263114 7:93417-93439 ACCTGTCCACACTTGGGGTTGGG - Intergenic
1019492479 7:1321837-1321859 CCCTGGGCTCAGTTTGGGTGGGG - Intergenic
1019608779 7:1924631-1924653 CCCTGGGATCATTTCTGGTTTGG - Intronic
1022682211 7:32559401-32559423 ACCAGGGCTCATTTCGGGTTTGG + Exonic
1023079122 7:36511355-36511377 CCCTGGGCACACTTGGTGAGGGG - Intergenic
1023860169 7:44213723-44213745 CCCTGCCCACATTGGGGGTCAGG - Exonic
1030187973 7:106781678-106781700 AATTGGGCACATTTAGGGTTGGG + Intergenic
1030359589 7:108580573-108580595 CCCTTGGCTCATTTGGGATCTGG + Intergenic
1033221478 7:139529133-139529155 CCCTAGGCTCCTTTGGGGTAAGG - Intronic
1034787803 7:153941424-153941446 TCCTGGGCCCCTCTGGGGTTTGG + Intronic
1034831820 7:154315283-154315305 ACCTGTACACATTGGGGGTTTGG + Intronic
1037315394 8:17595323-17595345 CCCTGGGCACCTTTGGGAGCAGG - Intronic
1038087969 8:24221061-24221083 ACCTGGGCCCATTTGGGGGTGGG - Intergenic
1044723604 8:95174091-95174113 CCCACAGAACATTTGGGGTTGGG + Intergenic
1045884742 8:107082265-107082287 GGCTGGGCAAATTTGGGGTGAGG - Intergenic
1047677346 8:127217338-127217360 ACCTTGGCACATTTTGGCTTGGG - Intergenic
1047718869 8:127620241-127620263 CAGTGACCACATTTGGGGTTTGG + Intergenic
1047757767 8:127931837-127931859 CCCTGGCCGTATTTGGGGATTGG - Intergenic
1047780297 8:128105588-128105610 TCTTGGGCACATTTGGGGAAAGG - Intergenic
1048428801 8:134348408-134348430 CACTGGGGCCTTTTGGGGTTGGG - Intergenic
1049287061 8:141781595-141781617 CCCTGGGCACATTTTCAGCTGGG - Intergenic
1050604808 9:7289741-7289763 CCGTGGGTACATTTGGGGAAGGG - Intergenic
1053564427 9:39233352-39233374 TTCTGTGCACATTAGGGGTTAGG + Intronic
1054132723 9:61385684-61385706 TTCTGTGCACATTAGGGGTTAGG - Intergenic
1055660778 9:78501931-78501953 CTCTGGGCACATTTTAGGATTGG - Intergenic
1058118576 9:101113505-101113527 CCCTGGGTACATTTGAATTTTGG - Intronic
1060210108 9:121704945-121704967 CCATGGGCACCTTTGGGGGCAGG + Intronic
1061491651 9:130948106-130948128 CCCTGGGCACATGGGTGGTCGGG - Intergenic
1062213318 9:135376216-135376238 GCCTGGGCCTATTTGGGGTCTGG + Intergenic
1062368120 9:136221653-136221675 CCCTGGGCAGATTTGGGCCCTGG - Intronic
1203736351 Un_GL000216v2:142981-143003 CCCTGGGAACATTCCGGGGTGGG + Intergenic
1185686629 X:1934143-1934165 CCATGAGCACAGTTGAGGTTGGG + Intergenic
1186756541 X:12677727-12677749 CCCTGGGCACATGTGGAATGTGG - Intronic
1187240307 X:17506936-17506958 CCCTGGCCACATTTAAGGCTGGG + Intronic
1189514164 X:41694563-41694585 CCCAGGGCACATTTAAGCTTTGG + Intronic
1190303450 X:49069221-49069243 CCATGGGCACAGAGGGGGTTGGG - Intronic
1192865668 X:75129432-75129454 ACTGGGGCCCATTTGGGGTTGGG + Intronic
1194324991 X:92503710-92503732 CACTGGGCACCTGTAGGGTTGGG + Intronic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1199768235 X:150956249-150956271 CCCTGCTGACATCTGGGGTTCGG - Intergenic
1200254553 X:154573140-154573162 ACCTGGGCAAACTTGGGTTTTGG + Intergenic
1200263216 X:154631268-154631290 ACCTGGGCAAACTTGGGTTTTGG - Intergenic
1200633723 Y:5622889-5622911 CACTGGGCACCTGTAGGGTTGGG + Intronic