ID: 1184109754

View in Genome Browser
Species Human (GRCh38)
Location 22:42387802-42387824
Sequence GTGGTCAGAGAGTGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 347}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184109754_1184109765 8 Left 1184109754 22:42387802-42387824 CCTGCCACCCACTCTCTGACCAC 0: 1
1: 0
2: 3
3: 53
4: 347
Right 1184109765 22:42387833-42387855 CATAGCCCAAGCCTCCTCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184109754 Original CRISPR GTGGTCAGAGAGTGGGTGGC AGG (reversed) Intronic
900415117 1:2531251-2531273 GTGGGTAGGGAGTGGGTGCCAGG + Intergenic
900511855 1:3064600-3064622 CTGGTCCCAGAGTGGGTAGCTGG - Intergenic
900570371 1:3355323-3355345 GAGGTCAGATGGTGGGTGGGTGG - Intronic
900627652 1:3616554-3616576 GGGGTGAGAGAGGGGGTGGGAGG + Intergenic
900847197 1:5113410-5113432 GTGGGCTGACAGTGGGTGGGAGG + Intergenic
900996168 1:6124684-6124706 GGGCTCAGGGAGTGGGGGGCCGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901272734 1:7965620-7965642 GTGCTTAGTAAGTGGGTGGCTGG + Intronic
902052902 1:13578217-13578239 GAGGACAGAGAGAGGGTGACTGG + Intergenic
902379346 1:16045346-16045368 GTGGTGACACAGTGGGTGCCAGG - Intronic
902414058 1:16228617-16228639 CTGGTCAGAGAGCAGGTGGAGGG - Intergenic
902571841 1:17352115-17352137 GTGGTCAGAGAGGTGATGGGAGG + Intronic
903362728 1:22786950-22786972 GTGGTGAGACAGTGTGTGGGTGG + Intronic
903422885 1:23231418-23231440 GTGCCCATGGAGTGGGTGGCAGG + Intergenic
903476896 1:23625760-23625782 GTTTTCACAGAGTGGGTGGGAGG + Intronic
903607400 1:24584954-24584976 GTGCCCAGTGAGTGGGTGGGCGG + Intronic
904011870 1:27394501-27394523 GTGGCCACATAGTGGGAGGCAGG - Exonic
904043091 1:27595306-27595328 GTGGGCAGAGTGTGTGTGTCTGG + Intronic
904471938 1:30741544-30741566 GTGCTGAGAGGGTGGGAGGCGGG - Intronic
904646681 1:31972807-31972829 GGGGTCAGGGAGTGGATAGCAGG + Intergenic
905252880 1:36660943-36660965 GTGGTCAGAGAGTGCATTACTGG + Intergenic
905793196 1:40801153-40801175 GTGGTCAGTGAGAGGCTGGCTGG + Intronic
907393272 1:54172569-54172591 GTGCTGGGAGAGTGGTTGGCAGG - Intronic
908008378 1:59750022-59750044 GTGGTCAGAGAATGGGATACTGG + Intronic
908682398 1:66676800-66676822 GTGGTGTGAGTGTGGGTGGGAGG - Intronic
908740039 1:67318012-67318034 GTGGTCAGGGAGGGGCTGTCTGG + Intronic
908981330 1:69962823-69962845 GAGGACAGAGGGTGGGAGGCGGG + Intronic
910947199 1:92606961-92606983 GTGGTGAGAGAGTGGGGGAAAGG - Intronic
911990214 1:104686653-104686675 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
912230620 1:107788340-107788362 GTGGGCAGAGTGAGGGTGGAAGG - Intronic
912550953 1:110484984-110485006 GTGGGCAGAGAGTGGCTGGTGGG - Intergenic
912926812 1:113920318-113920340 GAGGTCACAGAGAGGGAGGCAGG + Intergenic
913320799 1:117587142-117587164 GTGGTCACAGAGGGTCTGGCTGG + Intergenic
915100055 1:153492761-153492783 GTGGCAACAGAGAGGGTGGCTGG - Intergenic
915562713 1:156696738-156696760 TTGGTCACTGAGTGGCTGGCGGG - Intergenic
918116425 1:181502082-181502104 GTGGTTAGAGAGGGGATGGGAGG + Intronic
919265510 1:195259261-195259283 GTTGTCAGGGAGTTGGTGGGTGG - Intergenic
919515317 1:198515012-198515034 GAGGAAAGAGAGTAGGTGGCCGG + Intergenic
919527324 1:198669667-198669689 GGGGTCTGGGAGTGGCTGGCAGG - Intronic
920500082 1:206480261-206480283 GTGGGCAGAGAGGGGGAGGCGGG + Intronic
920580430 1:207101897-207101919 TTGGTGAGAGAGAAGGTGGCTGG + Intergenic
921056824 1:211548841-211548863 GAGGGATGAGAGTGGGTGGCAGG - Intergenic
921996950 1:221430567-221430589 GTGGTCAGTTAGTCAGTGGCTGG + Intergenic
922030831 1:221795963-221795985 GGGGTCATAGAGTTAGTGGCAGG - Intergenic
922180017 1:223226251-223226273 GAAGACAGAGAGTGGATGGCAGG + Intronic
922193687 1:223341451-223341473 GAGGACAGAGAGGGGGTGGGTGG - Intronic
922700713 1:227758487-227758509 GTGTTGAGAGTGTGGGTGGTGGG + Intronic
923107983 1:230868723-230868745 GGGGTCCGCGAGGGGGTGGCGGG - Intronic
923270846 1:232353856-232353878 GTGTTGAGAGGGTAGGTGGCAGG - Intergenic
923311786 1:232742682-232742704 GTGGAAAGGGAGTGGGTGGTGGG - Intergenic
923744238 1:236686222-236686244 GCTCTCAGAGCGTGGGTGGCAGG + Intergenic
1062910408 10:1208508-1208530 GAGGTGAGAGAATGGGAGGCAGG - Intronic
1065125327 10:22568455-22568477 GGGGTCAGAGAGTGGCTGTGGGG - Intronic
1065548911 10:26850698-26850720 GTTTTCAGTGAGTGGGTGGTTGG + Intronic
1067234975 10:44439639-44439661 GCGGTCAAAGGGTGGGTGGCTGG - Intergenic
1069735591 10:70652040-70652062 GGAGTCAGTGACTGGGTGGCAGG - Intergenic
1069821335 10:71230534-71230556 GAGGGCAGAGAGAAGGTGGCTGG - Intronic
1069862470 10:71480218-71480240 ATTCTCAGGGAGTGGGTGGCCGG + Intronic
1070697174 10:78572015-78572037 CTGGGCAGGGAGTGGGTGGTGGG + Intergenic
1070997840 10:80801803-80801825 GTTGTTAAAGAGTTGGTGGCAGG + Intergenic
1073650476 10:105353126-105353148 GTGGCCAGAGAGGTGATGGCAGG - Intergenic
1075196366 10:120362772-120362794 GTGATCAGAGAGTGACTGGGGGG - Intergenic
1075453173 10:122567536-122567558 GTGGTCACAGAGTGAGAGGCTGG - Intronic
1076888884 10:133274484-133274506 GAGGGCAGAGGGTGGGGGGCGGG + Intronic
1076921275 10:133455920-133455942 GGAGGCAGAGAGTGGGTGGGAGG + Intergenic
1077015564 11:397672-397694 GGGGGCAGCGAGTGGGTGGTCGG - Intronic
1077121021 11:908575-908597 GGGGTCAAAGACTGGGTGCCTGG - Intronic
1077305104 11:1865382-1865404 GTGGGCAGCGAGAGGGTGCCAGG + Intronic
1077305533 11:1867131-1867153 GTGGTCAGCCAGTGGGTTGGTGG + Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077406149 11:2383376-2383398 GTGGGCAGAGAGTGAGGGGTTGG + Intronic
1077977383 11:7262120-7262142 GTGGTCAGATTCTGGGTAGCTGG + Intronic
1078611061 11:12819987-12820009 GTGGGCAGAGACTGGGTGGTTGG + Intronic
1078931863 11:15918754-15918776 GTGGCCAGAGAGTGTGTGCAGGG - Intergenic
1079093412 11:17495903-17495925 ATGGTCAGTGAGTGGGTGAGTGG + Intronic
1079586374 11:22130265-22130287 GTGATCAGAGAGTGGTAGGGCGG - Intergenic
1081151389 11:39637129-39637151 GTGGTCAGAGAATGAGTCGGAGG + Intergenic
1081369508 11:42282839-42282861 GTTGTCAGAGAGTGGGTGCTGGG + Intergenic
1081979528 11:47257819-47257841 GTGGCGGGAGAGGGGGTGGCCGG + Intronic
1082027093 11:47580517-47580539 GTGGTCTGACAGTGGCTGGAAGG - Exonic
1083163162 11:60867876-60867898 GTGGTGAGGGGGTGGGGGGCTGG - Intronic
1083315581 11:61813177-61813199 GGGGACAGAGAGGGGGTGGAAGG - Intronic
1083541598 11:63515462-63515484 GAGGTCAGGGAGTGGATGGAAGG - Intronic
1083776901 11:64898442-64898464 GTGTTCAGAGGCAGGGTGGCTGG - Intronic
1083989851 11:66240300-66240322 GGGGGCAGAGAGAGGGTGGAGGG + Intronic
1084146081 11:67266186-67266208 GTGGTCAGAGAATGGGTCTCGGG + Intergenic
1084316664 11:68349653-68349675 GTGGGGAGAGCGTGGGTGGCAGG + Intronic
1084650158 11:70484886-70484908 GAGGGCAGCGAGTGGGTGGGCGG - Intronic
1084664560 11:70569451-70569473 CTGGGCAGAGGGTGGATGGCGGG + Intronic
1085276890 11:75306290-75306312 GGGGTCAGAGAGGGTCTGGCTGG - Intronic
1086325109 11:85690849-85690871 GTGGCAAGAGAGTGGTTGACTGG + Intergenic
1088159803 11:106855266-106855288 GTGGTGGGAAAGTGGATGGCTGG + Intronic
1088615621 11:111624802-111624824 GTGGTCAGAGGCTGGTTGGTTGG + Intronic
1089736044 11:120550799-120550821 GTGGTTGGAGAGTGAGTGGGAGG + Intronic
1090003205 11:122979480-122979502 GTGGGCAGAGCGTGGGTCGCCGG + Intronic
1091297838 11:134486368-134486390 GTGGACAGCGTGTGGGTGGAAGG - Intergenic
1091328452 11:134711375-134711397 TATGTCAGAGAGTTGGTGGCAGG + Intergenic
1092261375 12:6955041-6955063 GTGACCACAGTGTGGGTGGCAGG + Intronic
1093698085 12:22185666-22185688 GTTGCCAGAGAGTAGGTGGGAGG + Intronic
1094308506 12:29050187-29050209 CTGGGAAGAGAGTGGGGGGCAGG + Intergenic
1100299479 12:93294019-93294041 GGGGGCAGAGAGTGGGTGAACGG + Intergenic
1100354315 12:93814687-93814709 AGGCTCAGAGAGTTGGTGGCAGG - Intronic
1102784250 12:115591322-115591344 AAGGTCACAGAGTGGGTGGGAGG - Intergenic
1102825279 12:115943602-115943624 GTGGACAGAGCGTGGGTCTCAGG - Intergenic
1102998173 12:117365361-117365383 ATGGACAGAGTGTGGCTGGCCGG + Intronic
1103701104 12:122849134-122849156 GTGGTTAGAGAGCCTGTGGCAGG + Intronic
1104992708 12:132635122-132635144 GTGGCCAGAGAGTGGCTGGGTGG - Intronic
1105349512 13:19602497-19602519 GCTGCCAGAGAGTGGGTGGCTGG + Intergenic
1105433555 13:20358520-20358542 GTGGGCAGAGAGTGTGTCACAGG - Intergenic
1105638101 13:22235736-22235758 TGGGGCTGAGAGTGGGTGGCTGG + Intergenic
1106527283 13:30552495-30552517 GTGGACAGAGAGGGGGTGTGGGG - Intronic
1107753405 13:43593651-43593673 GTGTACAGAGATTGGGTGGCAGG - Intronic
1108444068 13:50488736-50488758 GTGGTCAGAGATTGTGGGGAGGG - Intronic
1108807804 13:54181409-54181431 GTGGGCAGAGGGTGGGAGGAGGG - Intergenic
1109558241 13:64010162-64010184 GTGGTGAGAGAATGGGTCTCAGG + Intergenic
1112249823 13:97769484-97769506 GTGGTCAATGACAGGGTGGCTGG + Intergenic
1112999417 13:105616429-105616451 GTGGTCAGATGGTGGGTGGATGG - Intergenic
1113056370 13:106272351-106272373 GTGGTCAGAGAGGAGGCAGCAGG + Intergenic
1113754848 13:112804017-112804039 GAGGGCAGAGAGGGGATGGCAGG - Intronic
1113754905 13:112804174-112804196 GAGGGCAGAGAGGGGATGGCAGG - Intronic
1114460062 14:22880702-22880724 GTGGTTAGAGAGTGAGTGCCTGG + Exonic
1114645630 14:24254613-24254635 GTGGTCAGAGAGTGAAGGCCAGG - Intronic
1114843114 14:26289445-26289467 GTAGACAGAGAGTAGGAGGCTGG - Intergenic
1115125032 14:29981886-29981908 GTATTCAGAGAGTCTGTGGCAGG - Intronic
1116676178 14:47908639-47908661 GTTGTCAGAGAGTGAGTGTAGGG + Intergenic
1118388036 14:65272945-65272967 GTGGCCAGGGAGTGGGTTACAGG - Intergenic
1118590604 14:67397878-67397900 GTGTTCAGGGAGGGGGTGTCTGG + Intronic
1119429358 14:74555759-74555781 AAAGGCAGAGAGTGGGTGGCTGG - Intronic
1120216045 14:81681703-81681725 GAGGGAAGAGAGTGGGGGGCTGG - Intergenic
1120230145 14:81833125-81833147 GTGGGCAGATGGTGGGAGGCAGG - Intergenic
1121487677 14:94331167-94331189 GTGGCCAGTGTGGGGGTGGCAGG + Intergenic
1121527167 14:94627182-94627204 GAGGTGAGAGAGAGGGTGGTGGG + Intergenic
1121725454 14:96145197-96145219 GGGGTTAGAGAGAGGGCGGCAGG + Intergenic
1122097169 14:99380718-99380740 GTGGTCAGGGAGGGGCAGGCTGG - Intergenic
1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG + Intronic
1122789958 14:104179960-104179982 GTGGACAGAGCGAGGGTGCCAGG + Intronic
1122805054 14:104252338-104252360 GTGGACAAAGGGTGGGTGGCAGG - Intergenic
1123013779 14:105363617-105363639 GTGTGGAGAGAGTGAGTGGCCGG - Intronic
1125466181 15:39955109-39955131 GAGGGCAGAGAGTGGCTGACAGG - Intronic
1125892631 15:43277637-43277659 GTGGCCTGTGAGTGGGAGGCAGG + Intronic
1126102582 15:45128985-45129007 GTGGTCCGGGTGTGGGTGGTGGG - Intronic
1126435290 15:48631406-48631428 GTGATAACAGAGTGGGTGGAGGG + Intronic
1126783012 15:52154556-52154578 GTGATGAGAGAGTGGTAGGCAGG - Intronic
1127645907 15:60958959-60958981 GTTGGCAGAGAGTTGGTTGCTGG - Intronic
1128157588 15:65401597-65401619 GAGTGCAGAGAGTGGGTGGGAGG + Intronic
1128227340 15:66011260-66011282 GTGGTATGGGAGTGGGAGGCAGG + Intronic
1128521256 15:68376339-68376361 TTGGTGAGAGAGGGGGTGACAGG - Intronic
1129193771 15:73952527-73952549 ATTGTAAGGGAGTGGGTGGCTGG - Intergenic
1129577806 15:76770197-76770219 CTGGTCAGGGGGTGGGGGGCTGG + Intronic
1129966157 15:79737685-79737707 CTGAGCAGAGAGTGGGTTGCCGG - Intergenic
1130652478 15:85769911-85769933 GTGAGCAGAGAGTGGGTGGGAGG - Intronic
1130956264 15:88629431-88629453 GTGGTGGGAGAGTGGCTGGAAGG + Intronic
1131079996 15:89526889-89526911 ATGGGGAGAGAGGGGGTGGCTGG - Intergenic
1132841470 16:1980260-1980282 AGGGGCAGAGAGTGGGAGGCTGG - Exonic
1133733572 16:8596658-8596680 GATGCCAGAGAGTGGGTGGGTGG + Intergenic
1133738537 16:8633660-8633682 GTGGTCACAGAGAGGGTGAGTGG - Intronic
1133856331 16:9552606-9552628 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
1133929926 16:10223822-10223844 GTTCTCAGAGTGTGGGTGACAGG + Intergenic
1134810021 16:17159385-17159407 GTGGGGAGAGAGCGGGAGGCAGG - Intronic
1135414366 16:22257618-22257640 GTGGACAGAGCGGGGGTGTCTGG - Intronic
1138272606 16:55706753-55706775 GCTGTCAGAGAGTGTGTGGTGGG + Intergenic
1139164291 16:64547808-64547830 GAGGGCAGAGAGTGGGAGGGAGG - Intergenic
1139188528 16:64835461-64835483 GGGGTGAGAGAGAGAGTGGCAGG - Intergenic
1140685963 16:77434566-77434588 GAGCTCCGAGAGCGGGTGGCAGG - Intronic
1141145814 16:81529373-81529395 GTGGGCAGAGTGTGAGGGGCTGG + Intronic
1142117703 16:88368615-88368637 GTGGCCTGAGAGGGTGTGGCTGG + Intergenic
1142750623 17:1985357-1985379 GGGGACAGAGAGTAGGAGGCAGG - Intronic
1143126113 17:4641742-4641764 GGGGTCGGAATGTGGGTGGCAGG + Intronic
1143137696 17:4720874-4720896 GAGGGCAGGGAGTGGGAGGCTGG + Intronic
1144447685 17:15346081-15346103 GTGGCCACAGAGCAGGTGGCTGG + Intergenic
1144637933 17:16922950-16922972 GCAGTCAAAGAGAGGGTGGCAGG + Intergenic
1145014583 17:19387864-19387886 GTGGCCAGAGTGAGGGGGGCTGG - Intergenic
1147264688 17:39227540-39227562 GTGGTAAGATTGTGGGTGGGGGG + Intergenic
1147375784 17:40021834-40021856 CTGGTCAGAGAGGGTGTGGCAGG - Intronic
1149053047 17:52329508-52329530 GAGGTCAAAGAATAGGTGGCCGG + Intergenic
1149422828 17:56527806-56527828 GTGGCCAAAGGGTGGGTGGAGGG - Intergenic
1150122787 17:62617554-62617576 GGGGTCAGAGAGCAGCTGGCTGG + Intergenic
1151375779 17:73687876-73687898 GTGGGCAGGGAGTGGAAGGCAGG + Intergenic
1152748037 17:82050202-82050224 CTGGGCAGAGAGGGGGTGTCTGG - Intronic
1153001854 18:463033-463055 GGAGTCAGGGAGAGGGTGGCAGG + Intronic
1155087659 18:22473523-22473545 CTGGTCAGAGAGTGAGAGGAGGG - Intergenic
1156557097 18:38079735-38079757 ATGGCCAGAGAGTGTGTGTCTGG - Intergenic
1157295306 18:46437884-46437906 GTGGGCAGAGGGTGGGTGGAGGG + Intronic
1157591566 18:48839218-48839240 GTGCTCAGAGAGAGGGTGGCAGG - Intronic
1157802139 18:50629487-50629509 GAAGTCAGAGAGTTGGAGGCAGG + Intronic
1157804081 18:50645059-50645081 CAGGCCAGGGAGTGGGTGGCTGG + Intronic
1159044250 18:63353793-63353815 GTTGTCAGAGATTGGGTGTGGGG + Intronic
1160500971 18:79400886-79400908 GAGGTCAGGGGGAGGGTGGCTGG - Intronic
1160543735 18:79639265-79639287 CTGGTGAGGGAGTGGGGGGCTGG + Intergenic
1160750961 19:734238-734260 GTGGCCAGAGAGGGGATGGCAGG + Intronic
1161347781 19:3776747-3776769 GTGGATAGTGAGTGGGTGGATGG + Intergenic
1162936961 19:13986213-13986235 GTGGGCAGGGAGTGGGGGGCTGG + Intronic
1162947903 19:14054779-14054801 GTGGTCTGGGAGGGGGTGGGTGG - Exonic
1163250772 19:16125182-16125204 CTTGTCAGCGAGTGCGTGGCAGG + Intronic
1163304676 19:16470502-16470524 GTAGTCAGGGGGTGGGGGGCGGG - Intronic
1163427348 19:17246587-17246609 GTGGTCTGAGACCGGCTGGCCGG + Intronic
1163610056 19:18295936-18295958 GTGGTAAGTGGATGGGTGGCTGG - Intergenic
1163977972 19:20870445-20870467 GTGATGAGTGAGTGGGTGACGGG - Intergenic
1164805018 19:31109743-31109765 GTGGACAGAGAGAGGGGAGCCGG - Intergenic
1164828890 19:31305164-31305186 GTGGCAGGAGAGGGGGTGGCTGG - Intronic
1165256449 19:34579483-34579505 GGGGTCAGAGAATGGATGGATGG + Intergenic
1165643281 19:37408450-37408472 GTGCTCAGTACGTGGGTGGCAGG - Intergenic
1166681523 19:44770617-44770639 GTGGTCAGAGTCTGGGGAGCTGG + Intergenic
1166688073 19:44808077-44808099 GTGGTCAGAACGTGGGAGGGTGG - Intergenic
1167752252 19:51388136-51388158 GAGGTCAGTGAGTGGGTGGGGGG - Intergenic
925522473 2:4762133-4762155 GTGGTCAGTGAGTAGCTGACAGG + Intergenic
925946615 2:8870017-8870039 GTGGTGGGAGACTGGGGGGCAGG - Intronic
926269259 2:11352827-11352849 GTGGTCAGAAAGAGGATGGGGGG + Intergenic
926326018 2:11785645-11785667 GTGGTGAGAGAGGGGGCGGGAGG - Intronic
926436818 2:12846662-12846684 GAGGTTAGAGAGTGAGAGGCAGG + Intergenic
927648559 2:24897122-24897144 GTTGAAAGAGGGTGGGTGGCTGG - Intronic
927705902 2:25296445-25296467 GTGGTCAGATGGTGAGGGGCTGG + Intronic
928200782 2:29246475-29246497 GTGTCTAGAGGGTGGGTGGCTGG - Intronic
928319619 2:30272724-30272746 ATGGTCAGATAGTGGGTGGTGGG - Intronic
932070126 2:68611775-68611797 GTGGTGAGAGAGAGGGGGGCGGG + Intronic
932125783 2:69144494-69144516 GGGGAGAGAGAGTGGATGGCGGG + Intronic
934035598 2:88086374-88086396 GTGTGCAGTCAGTGGGTGGCAGG + Intronic
934680073 2:96277463-96277485 GTGGACCGAGCGTGGGTTGCGGG - Intronic
937000207 2:118458836-118458858 GGGGTCAGAGGATGGGAGGCAGG - Intergenic
937091411 2:119208961-119208983 GTGGTCAGAGGGTGGCTGAGGGG - Intergenic
937957286 2:127428482-127428504 ATGGTCTGCGAGAGGGTGGCGGG - Exonic
940292326 2:152089524-152089546 GTGAGCAGAGAATGGGTGACAGG - Intronic
942182927 2:173397482-173397504 GTGGAGAGAAAATGGGTGGCAGG + Intergenic
944591116 2:201218755-201218777 GAGATCAGAGAGAGGGTGGGTGG - Exonic
945219209 2:207466991-207467013 GTGGTCGGAGAGTGGTTGGTTGG - Intergenic
946125719 2:217560893-217560915 GTGGTGAGAGGGTGGGGGGTGGG - Intronic
946689140 2:222297843-222297865 GTGTGAAGGGAGTGGGTGGCGGG + Intronic
947769455 2:232659448-232659470 GAGGGCAGGGAGGGGGTGGCTGG + Intronic
948045485 2:234940552-234940574 GAGGGCAGAGAGTGGAGGGCAGG - Intergenic
948326594 2:237126753-237126775 GAGGTCGGAGGGTGCGTGGCTGG - Intergenic
948443222 2:238011246-238011268 GTGGTCAGAGAGTGAGGTGGAGG - Intronic
948681665 2:239639339-239639361 GGGGTCAGAGAGTCAGTGTCTGG - Intergenic
948744489 2:240077331-240077353 GTGGTCAGAGATTGCTTGTCTGG + Intergenic
948794257 2:240394096-240394118 GGGGTCGCAGAGTGGGTGGCAGG - Intergenic
1168809489 20:695082-695104 GTGGGGAGAGGGTGCGTGGCTGG - Intergenic
1170783637 20:19449069-19449091 GTGGGCAGGGAGAGGGAGGCAGG + Intronic
1171486472 20:25489808-25489830 CTGGGCAGAGTGGGGGTGGCGGG - Intronic
1172054698 20:32146011-32146033 GTGGTGAGAGGGTGGTAGGCAGG + Intronic
1173001282 20:39107536-39107558 GATGTCAGAGAGTGGGTCGGGGG + Intergenic
1173347384 20:42213481-42213503 GCGGCCAGAGAGTGGGTGAGTGG - Intronic
1173438705 20:43056288-43056310 GTGGGATGAGAGTGGGTGGAAGG - Intronic
1173856974 20:46256584-46256606 GAGGTCAGAGAGTGTGGGGGTGG + Intronic
1173998780 20:47359230-47359252 GTGATCAGAGAGAGGGAGGGAGG - Intergenic
1174055326 20:47794596-47794618 GTGGGGAGAGGGTGGGAGGCCGG + Intergenic
1174066023 20:47866698-47866720 GCGGTCAGAGGGTGGGTGCCAGG - Intergenic
1174157990 20:48528955-48528977 GCGGTCAGAGGGTGGGTGCCAGG + Intergenic
1174215285 20:48911776-48911798 GAGGTCAGGGAGAGGGAGGCAGG - Intergenic
1174567849 20:51479871-51479893 GAGGACAGAGAGAGGGTGGCAGG - Intronic
1174657884 20:52186870-52186892 GTGGTCTGAGTCTGGGTGGCAGG + Exonic
1175207443 20:57322171-57322193 GTGGTAGGAAAGTGGGTGACTGG - Intergenic
1175621067 20:60448019-60448041 GTGTTGAGTGTGTGGGTGGCAGG + Intergenic
1175876516 20:62232801-62232823 GAGGTCAGGGAGGGGGTGGAGGG - Intronic
1175887430 20:62300455-62300477 GTGGCCACAGAGTGGGTGGGGGG - Intergenic
1175998722 20:62822506-62822528 TCCGTCAGAGAGTGGGTGGGTGG + Intronic
1175999904 20:62827114-62827136 GTGGTCAGAGAGTGGGATGGGGG - Intronic
1177220210 21:18182871-18182893 ATGTGGAGAGAGTGGGTGGCAGG - Intronic
1177493360 21:21856918-21856940 GAGGACAGAGAGTGGGAGGAAGG + Intergenic
1178265752 21:31141609-31141631 CTGAGCAGAGAGTGGGTGGCAGG + Intronic
1179035568 21:37756369-37756391 ACGGTCAGAGAATGGGTGGTGGG + Intronic
1179294575 21:40049754-40049776 GTGGTCAGCGAGTGCCAGGCAGG - Intronic
1181286839 22:21758637-21758659 GTGGGCGGAGACTGAGTGGCTGG - Exonic
1181345019 22:22213417-22213439 GTGGTCAGAGAGTTGGCAGAGGG + Intergenic
1181675661 22:24450026-24450048 GTGGTCAGAGACAGGCTGGAGGG - Intergenic
1181822619 22:25487573-25487595 TTGGTGGGAGAGTGGGTGGATGG + Intergenic
1181855647 22:25779890-25779912 TTGGGCAGGGAGTGGGTGGCAGG + Intronic
1184109754 22:42387802-42387824 GTGGTCAGAGAGTGGGTGGCAGG - Intronic
1184278185 22:43422214-43422236 TTGCACAGAGAGTAGGTGGCAGG - Intronic
1185398242 22:50603463-50603485 GTGGTCAGACGGAGGGTGGTGGG - Exonic
950443369 3:13022579-13022601 GAGCTCAGAGAGAGGGAGGCGGG + Intronic
950694832 3:14690826-14690848 GTGGTGGGAGGGTGGATGGCAGG + Intronic
952669455 3:35948536-35948558 GCGGGCAGAGAGTGGGAGGAGGG - Intergenic
952721868 3:36542004-36542026 ATGGAGAGAGAATGGGTGGCAGG + Intronic
952954001 3:38545372-38545394 CTTGTCAGAGACAGGGTGGCTGG - Intergenic
953093098 3:39749191-39749213 CTTGTCAGAGAGTGGTTTGCTGG - Intergenic
954054765 3:48012666-48012688 GTCATCTGAGAGTGTGTGGCTGG - Intronic
954081934 3:48217560-48217582 GTGGCCAGAGACTGTGTGCCAGG - Intergenic
954924567 3:54220984-54221006 GGGGTGAGAAAGTAGGTGGCTGG + Intronic
957398756 3:79680907-79680929 GTGGTCAGAGAGTGAGATGCTGG + Intronic
958734088 3:97989336-97989358 GTGGTCAGTGGGTGAGTGGGTGG + Intronic
960763151 3:121096106-121096128 ATTGTCAGACAGTGGGGGGCAGG - Intronic
962286056 3:134086316-134086338 GAGGAGAGAGAGTGGATGGCAGG + Intronic
962343859 3:134605858-134605880 GTGCTCAGAGAGTGGGATGAGGG - Intronic
962564692 3:136645820-136645842 GTGGTCAGAAAGTGAGTAGATGG - Intronic
963543399 3:146623981-146624003 ACGGACAGAGAGTGGGTGTCTGG + Intergenic
964344712 3:155744461-155744483 GCGGTCAGAGAGAGGGTCCCGGG + Intronic
967104558 3:186244872-186244894 TTGCTCAGAGAGTGGGAGGTGGG - Intronic
967687800 3:192437856-192437878 GTGGGCAAAGAGTAGGAGGCAGG - Intronic
968741693 4:2334619-2334641 GTGGTCGGGGAGTGGGGGGTGGG - Intronic
969280493 4:6167370-6167392 GTGGTGAGTGAGGAGGTGGCTGG - Intronic
969331194 4:6474218-6474240 GTGGACAGAGAGTGGGGGGCTGG - Intronic
970752229 4:19377637-19377659 GTGGTCAGAGTGTGTGTCGCTGG - Intergenic
970951211 4:21757716-21757738 GGGGTCATAGATTGGGTGGCAGG - Intronic
972922465 4:43960641-43960663 TTGGTCAGTGAGTAGGTGGGGGG + Intergenic
974135863 4:57817121-57817143 GTGGTCAGGGATTGGGAGGGAGG + Intergenic
981944803 4:150328737-150328759 GCAGTCAGAGGGTGGGTGGGAGG + Intronic
983631045 4:169849630-169849652 GAGGTCAGAGTGTATGTGGCTGG - Intergenic
984677663 4:182568957-182568979 GATGTCAGAGAGTGGTTGCCTGG + Intronic
985040091 4:185881680-185881702 GTGGTGAGAGAATGGGTGTGAGG + Intronic
985178925 4:187235485-187235507 GTGGGCGGCGAGGGGGTGGCTGG + Intergenic
985560938 5:585362-585384 TAGGTCAGGGAGTGGGTGGGTGG + Intergenic
985654997 5:1126629-1126651 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
985837328 5:2280819-2280841 GTGGTGAATGAGTGGGTGGGTGG + Intergenic
986281694 5:6328508-6328530 GGAGTCAGAGAGTGGGATGCTGG - Intergenic
987730887 5:21771059-21771081 GAGGACAGAGAGTGGGAGGAGGG + Intronic
987964647 5:24855748-24855770 TAGGCCAGTGAGTGGGTGGCGGG - Intergenic
989135052 5:38145432-38145454 ATGGTCAGAGAGAGAGAGGCAGG - Intergenic
989352347 5:40500589-40500611 GTGTTCAGAGAGGGGGAAGCTGG - Intergenic
991026803 5:62038272-62038294 GTGGGCAGAGATAGGCTGGCTGG + Intergenic
992021938 5:72633492-72633514 GTAGTCACAGAGAGGGAGGCAGG + Intergenic
992409076 5:76487686-76487708 GAGGTTAGAGAATGGGGGGCAGG + Intronic
992918348 5:81483034-81483056 GTGATCAGGGAGTGGCTGGTCGG + Intronic
995526854 5:113057163-113057185 GTGGTCAGAGAGGGAGTGCGTGG + Intronic
995767807 5:115637941-115637963 GTAGTGAGAGGGTGAGTGGCAGG + Intergenic
997991012 5:138544251-138544273 GTGCTCTGAGAGTGTATGGCGGG + Intergenic
998806498 5:145922172-145922194 CTGGGCAGAGGGTGTGTGGCAGG - Intergenic
1001231609 5:169993693-169993715 GTGGTCCAAGAGTCGGTGGGTGG - Intronic
1001490981 5:172155094-172155116 ATGGACAGAAAGTGGGTGGCTGG + Intronic
1002019918 5:176356935-176356957 GTTGCCAGGGAGTGGGTGGGGGG + Intronic
1002191337 5:177479314-177479336 GAGGCCAGGGTGTGGGTGGCGGG - Intergenic
1002774220 6:315018-315040 CTGGTCAGGGAGTGGCTGGGTGG + Intronic
1003565568 6:7219489-7219511 GTGGTCAGGCAGTGGCTGGCGGG + Intronic
1003948178 6:11094072-11094094 GTGGCCAGAGCGCGGGAGGCAGG - Exonic
1005559535 6:27024242-27024264 AAGGTCAAAGAGTGGGTGGTGGG + Intergenic
1005838528 6:29725052-29725074 ATGGTCAGAGATGGGGTGGTGGG - Exonic
1005859436 6:29889350-29889372 ATGGTCAGAGATGGGGTGGTGGG - Intergenic
1005867000 6:29944143-29944165 ATGGTCAGAGATGGGGTGGTGGG - Exonic
1005868707 6:29957459-29957481 ATGGTCAGAGATGGGGTGGTGGG - Intergenic
1005987546 6:30884168-30884190 GTGGGCTGCGAGTGGGTGGAGGG + Intronic
1006042940 6:31270442-31270464 ATGGTCAGAGAGGGGGTGGTGGG + Exonic
1006052525 6:31355549-31355571 ATGGTCAGAGATGGGGTGGTGGG + Exonic
1008046301 6:46854663-46854685 GTGGGCAGAGAGTGTGTGTCGGG + Intronic
1008081209 6:47196129-47196151 GTGGCTAAAGAGTGGGTGGAAGG - Intergenic
1010314893 6:74436557-74436579 CTGGTCAGGGAGTGGGTGACTGG - Intergenic
1013004622 6:106060788-106060810 GTGAACTGGGAGTGGGTGGCTGG + Intergenic
1013290599 6:108715949-108715971 ATTGTCACAGAGTGGGAGGCAGG + Intergenic
1013457965 6:110349178-110349200 GTAGTCAGAGAGTTGGAGACGGG - Intronic
1016728873 6:147406853-147406875 CTGGTCAGGGAGTGCGTGTCAGG + Intergenic
1016793847 6:148096296-148096318 ATGTTCAGAGAGTTGGTGGGTGG + Intergenic
1018215396 6:161521679-161521701 AAGGTCAGGGAGTGGCTGGCTGG + Intronic
1019811578 7:3169041-3169063 GTGGTCAGAGATGGGTTGGTTGG - Intronic
1022276208 7:28857364-28857386 GTTGTCAGAGACTGGGTGTGGGG + Intergenic
1022385771 7:29897860-29897882 GTGGTAAAAGAGTGGGGTGCTGG - Intronic
1023113498 7:36838009-36838031 GTGGGCAGAGATGGGGTGGAAGG - Intergenic
1023789158 7:43737915-43737937 GAGGACAGAGAGAGGGTGGGAGG + Intergenic
1023891929 7:44399036-44399058 GTGGTCTGAGTGTGGCTGGAAGG + Intronic
1024161281 7:46679109-46679131 ATGGTCAGAGAGTGGGTGCAAGG - Intronic
1024526049 7:50350158-50350180 CTGGTCAGAGAGTGGGCAGCCGG - Intronic
1025237665 7:57245546-57245568 GTGGGGAGAGGGTGGGAGGCTGG - Intergenic
1026461027 7:70615217-70615239 GGGGTGGAAGAGTGGGTGGCAGG + Intronic
1027986555 7:85298895-85298917 GTTGGCTGAGAGTGTGTGGCTGG + Intergenic
1031868430 7:127065365-127065387 GAGGTGAGAGAGTGGGAGGAGGG + Intronic
1032112358 7:129086885-129086907 CAGGTCAGAGTGAGGGTGGCTGG + Intergenic
1032254244 7:130284484-130284506 GTTGGCATAGAGTGGGTGGTTGG + Intronic
1032696766 7:134343980-134344002 GTGGACAGAGCGTGGGTGGAAGG - Intergenic
1032803722 7:135336328-135336350 GTGGTGAATGGGTGGGTGGCTGG - Intergenic
1032824818 7:135558453-135558475 GTGGTCAGGAAGAGGGTGGCGGG + Intronic
1033769047 7:144527935-144527957 GAGGGCAGAGGGTGGGAGGCGGG + Intronic
1036777286 8:11622369-11622391 GTTGGCAGTGAGGGGGTGGCAGG - Intergenic
1037921268 8:22807895-22807917 GTGGACAGAGGTTGGGTGGGTGG - Intronic
1038895608 8:31778329-31778351 GTGACCAGAGAGAGGCTGGCTGG - Intronic
1039532187 8:38272729-38272751 GTGGTCAGAGTGTAAGTGGCTGG - Exonic
1039913529 8:41843397-41843419 GTGGGCGGGGAGTGGGTGGGGGG - Intronic
1040967840 8:53101992-53102014 GAGGTGAGGGAATGGGTGGCTGG + Intergenic
1041973766 8:63773738-63773760 GTGCTGAGAGATTGGGTGGCTGG + Intergenic
1042612584 8:70614832-70614854 GTGGTGAGAGAGTGGGATGCTGG + Intronic
1048502158 8:134988239-134988261 GTGGTCATAGAGAAAGTGGCAGG + Intergenic
1049462868 8:142738227-142738249 CGGGTCAGGGAATGGGTGGCTGG + Intergenic
1049795348 8:144494802-144494824 GTGGGCTGTGAGTGGCTGGCAGG + Intronic
1051301015 9:15650999-15651021 GGTGTCAGGGTGTGGGTGGCAGG - Intronic
1051785986 9:20744141-20744163 ATGGTCAGACGGTGGGTGGGTGG + Intronic
1052323437 9:27192708-27192730 GTGGTGGGTGAGTGGGTGGGTGG + Intronic
1052823532 9:33158754-33158776 GTGGTCAGAGAGAGGAAGCCTGG - Intronic
1057164104 9:92913043-92913065 GGGGTCAGAAAGTGGGTGGCAGG - Intergenic
1057857354 9:98611726-98611748 GTGGTGGGAGTGTGCGTGGCTGG - Intronic
1058172233 9:101695578-101695600 GTGGAAAGAGAGGAGGTGGCTGG + Intronic
1058439256 9:104992016-104992038 CTCCACAGAGAGTGGGTGGCAGG - Intergenic
1059908933 9:119021105-119021127 GTGGGCACAGAGTGGCTAGCTGG + Intergenic
1060113829 9:120925890-120925912 GTGGGCAGAAAGTGGGTGCCAGG - Intronic
1060407766 9:123381340-123381362 CTGGGCAGAGAGAGAGTGGCGGG + Exonic
1060522683 9:124302660-124302682 GGGGTCAGAGAGGGCGTGCCAGG - Intronic
1060896048 9:127218305-127218327 GTGTGCAGAGGGTGGGTGGCTGG - Intronic
1060942291 9:127549923-127549945 TGGGACAGAGAGTGGGAGGCTGG - Intronic
1061545056 9:131299590-131299612 GTGGTCTGAGGGTGGCAGGCGGG + Intronic
1061946261 9:133909873-133909895 AAGGACAGAGAGTGAGTGGCAGG - Intronic
1062224899 9:135444329-135444351 GTGGTTAGAGTGGGGGGGGCGGG + Intergenic
1062352502 9:136145917-136145939 GGGGTCAGGATGTGGGTGGCAGG + Intergenic
1062432371 9:136531883-136531905 GTGGTCAGAGAGCAGGGAGCCGG - Intronic
1062722302 9:138050776-138050798 CTGGTTTGAGAGTGGGTGTCGGG + Intronic
1186873327 X:13793273-13793295 GGGGTCAGAGGGTGGCTTGCAGG - Intronic
1189131487 X:38502643-38502665 ATGCTCAGAGAGAGGGTGGTTGG + Intronic
1189268917 X:39736682-39736704 AGGCTCAGAGAGTGGGTGGGGGG - Intergenic
1190888926 X:54552320-54552342 GTGGGCAGAGTGTGAGTGGCTGG - Exonic
1191842422 X:65522738-65522760 GTGGTCACCGAGTGGGATGCTGG + Intronic
1192445110 X:71205322-71205344 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
1195468842 X:105210982-105211004 GGGGTCAAAAGGTGGGTGGCAGG - Intronic
1195831625 X:109065716-109065738 TCTGTCAGAGAGTGGGTGGTGGG + Intergenic
1195867598 X:109450033-109450055 GTGGGCAGAGAGAGGGAGGAAGG + Intronic
1196188583 X:112771487-112771509 GTGGTCAGAGAGTGGGGTACTGG + Intergenic
1196216810 X:113062392-113062414 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
1196611421 X:117718978-117719000 GTGATTTGAGAGAGGGTGGCTGG - Intergenic
1200058689 X:153474542-153474564 GTGGACAGAGTCTGGCTGGCAGG + Intronic
1200107393 X:153722846-153722868 GTGGACCAAGAGTGGGTGGGAGG + Intronic
1201757055 Y:17497776-17497798 CTGGTCTGAGGGTGGGGGGCTGG + Intergenic
1201844499 Y:18408208-18408230 CTGGTCTGAGGGTGGGGGGCTGG - Intergenic